Lab Report 3 Bio 1

docx

School

University of Iowa *

*We aren’t endorsed by this school

Course

Subject

Biology

Date

Apr 3, 2024

Type

docx

Pages

Uploaded by AmbassadorMetal7079

1 Investigating Genetic Variation among the LCT and TAS2R38 Loci Bethel Tewabe Lab Section: 0A29 Team Members: Colten Kuhn, Ashley Jokovich, Gavin Smith 11/26/2023 I. Introduction

2 The overall objective of project 3 was to understand genetic variation as well as understand how scientists identify and measure these differences. The theory of evolution was first discussed in a series of experiments performed by Charles Darwin where he concluded that species evolved through natural selection. Although a pivotal moment in science, it did not explain how this occurred. Mendel’s experiments with pea plants yielded the discovery of various allele traits and how they could present, the most known ones being the dominant and recessive. Putting together the work of Charles Darwin and Mendel, Godfrey Hardy and Wilhelm Weinberg discovered two mathematical equations that could show frequencies of these two allele traits and how they present within a specific population, thus, explaining how/if it changes over time. These equations will be further discussed and implemented in the Results section. As far as gene variation, there are many different ways that they can occur, but the most prevalent way is through single nucleotide polymorphism, also called SNPs. SNPs occurs when a single nucleotide in a sequence is different from the norm of the population and this difference causes variations in how specific aspects are phenotypically expressed and/or how they are perceived similar to the LCT and TAS2R38 gene variation that was investigated in this experiment. The LCT gene is located on the second chromosome and determines whether an individual would be lactose tolerant or lactose intolerant. This gene encodes for the enzyme lactase, used in catalyzing the breakdown of the disaccharide lactose, which is the most prominent sugar in milk and dairy products, into its hydrolyzed monosaccharides, glucose and galactose. These monosaccharides would then be absorbed by the cells of the small intestine to be carried through the circulatory system to be disbursed among all the cells of the body to be used as an energy reserve (Grewe, B., McAllister, B., & El Zawily, A. 2023). This is what would occur within individuals with the LCT gene that codes for the lactase enzyme. In those who are lactose intolerant, LCT gene does not code for the lactase enzyme, the lactose disaccharide would not be broken down into its monosaccharide forms needed for absorption but would instead carry on as a whole into the colon and be fermented by the bacteria that reside there. This can cause all or some of these digestive symptoms: cramping, bloating, flatulence and diarrhea (Grewe, B., McAllister, B., & El Zawily, A. 2023).

3 TAS2R38 gene is located on the seventh chromosome. It encodes for the presence of a protein that allows for some individuals to taste the bitterness of PTC and some individuals to not. PTC sensitivity was first recognized in the early 1930s when a scientist, Arthur L. Fox, was pouring some of the PTC powder into a separate bottle and some particles got wafted into the air. Another scientist, C.R. Noller, who was within the vicinity inhaled some of this powder and complained about the bitterness, yet Fox insisted the powder tasted like nothing. After taking turns tasting the powder, they both realized how distinctly different they biologically reacted to the powder. Because of this, Fox decided to test this power on a larger population of people and discovered that distinct variations existed among differences in ethnicity, sex and age. As well as there were more tasters in comparison to non- tasters (Wooding, 2006). Today, PTC tasting has been vastly tested and studied among geneticists and curious biology students. The specific objectives of this experiment were successful DNA extraction, utilizing PCR (polymerase chain reaction) to amplify certain segments of the DNA, and lastly to investigate the chosen loci and how those loci will be distinguished (Grewe, B., McAllister, B., & El Zawily, A. 2023). We hypothesized that LCT and TAS2R38 will not be Hardy Weinberg, meaning that they are still evolving, because the condition of no gene flow would be violated in both cases. The null hypothesis, that both loci will fit Hardy-Weinberg, will be the one used in this experiment to, in the end, be able to accept or reject our experimental hypothesis. To achieve these objectives, the experiment was broken up into two labs. The first one covering DNA extraction and PCR amplification and the second one tackling restriction fragment length polymorphism (RFLP) analysis by using a gel electrophoresis. During the first lab, each individual swabbed the inside of their cheeks to grab epithelial cells. From these cells, DNA was extracted by placing the swabs in DNA extraction solution the tube in 65 °C water and 98 °C water with vortexing for 10-15 seconds in between. Next, the DNA was amplified through PCR with the use of forward and reverse primer mixes to exponentially copy the DNA. During our second lab, we added in restriction enzyme cocktails that were specific to each gene and the extracted DNA into tubes and incubated them for 45-60 minutes. Then, uncut DNA and PCR DNA was placed into a gel electrophoresis chamber which would show the DNA band sizes and length allowing determination

Your preview ends here

Eager to read complete document? Join bartleby learn and gain access to the full version

Access to all documents
Unlimited textbook solutions
24/7 expert homework help

4 of genotypes. Lastly, the Hardy Weinberg Equilibrium and Chi squared statistical analysis was used to either reject or support the null hypothesis. II. Materials and Methods (2 pages maximum) At the beginning of Wet lab 1, the class taste tested a strip of PTC paper, and the results were recorded. Students that experienced an extremely bitter taste were reported as tasters (T) and students who experienced no taste at all were recorded as non-tasters (t). There was also another category of students who could taste the bitterness, but not as strong as the tasters, that were labeled partial tasters (PT). Following this, students obtained a template DNA strand by swabbing the inside of both cheeks approximately 20 times, collecting epithelial cells (Grewe, B., McAllister, B., & El Zawily, A. (2023). The DNA extraction was performed by placing the swab in a PCR tube containing DNA extraction solution. The swabs were rotated 10 times and then placed on the vortex for 10 seconds and incubated in 65°C water for one minute. Once that was done, the tube was placed on the vortex for another 15 seconds and, again, the tubes were submerged in 98°C water for 2 minutes. Finally, the tube was placed on the vortex for another 15 seconds, and then allowed to cool to room temperature before being put into a cup of ice (Grewe, B., McAllister, B., & El Zawily, A. 2023). The next step was performed to set up the PCR tube of the target loci, LCT and TAS2R38. In order for the PCR amplification to be successful, each tube needed to consist of three things. The first being a 0.2 ml PCR master mix which contained Taq DNA polymerase, the four deoxyribonucleotides, and required buffer and salts (Grewe, B., McAllister, B., & El Zawily, A. 2023). Second, the DNA sample. Third, a specific primer mix for each locus. Listed below are the primers used for the target loci, each were used at 500nM concentration: LCT target loci primers:  LCT-F primer sequence: 5’ GTTGAATGCTCATACGACCAT 3’  LCT-R primer sequence: 5’ TGCTTTGGTTGAAGCGAAGA 3’ TAS2R38 target loci primers:  TAS2R38-F primer sequence: 5’AACTGGCAGATTAAAGATCTCAATTTAT3’  TAS2R38-R primer sequence: 5’AACACAAACCATCACCCCTATTTT3’ Each PCR tube already contained 0.2 ml of the PCR mix, so to each, 20 microliters of the primer mix was added, and 5 microliters of the DNA sample was added. Before loading into the Thermocycler, the tubes were centrifuged briefly for

5 ~5 seconds (Grewe, B., McAllister, B., & El Zawily, A. 2023). Next the tubes, for both LCT and TAS2R38, were cycled 40 times for 30 seconds and two different temperatures. The first temperature was 95°C, this was to completely denature all of the DNA. Then at 55°C, which was for annealing the DNA and primers. Lastly, the thermocycler was set to 72°C for 5 minutes to complete the synthesis of the new DNA (Grewe, B., McAllister, B., & El Zawily, A. 2023). Once PCR tubes were obtained, they were treated with restriction enzymes, which cleave the DNA of one of the alleles, so that the two alleles can be distinguished from one another. For the LCT locus, 10 µl of the restriction enzyme cocktail containing BsmF1 was pipetted into the PCR tube, with 5 µl of sterile water, and 5 µl of the PCR DNA. The LCT tubes were then centrifuged for ~5 seconds and then placed in a 65°C water bath for 45-60 minutes. The exact same was done for the TAS2R38, except the restriction enzyme for this locus was Fnu4H1, and the tubes were incubated in a 37°C water bath. Leftover contents in the LCT and TAS2R38 tubes were kept for uncut samples to be used in the gel electrophoresis analysis. In the last part of our wet lab, two gels were created. A 40 ml of a 1.6% agragose solution was needed, so after doing to math, it was concluded that 0.64 grams of agragose was necessary. The agragose was added to an Erlenmeyer flask with 40 ml of 1X TBE (1X Tris/Borate/EDTA) buffer, and this was mixed together. The solution was microwaved on high power for 1 minute, until boiling. Once the agragose was cooled, ethidium bromide was added. This is a mutagenic agent that inserts itself into the DNA like a base pair to stain the DNA fragments as they move through the gel (Grewe, B., McAllister, B., & El Zawily, A. 2023). The flask was swirled and then poured into the gel tray, careful to avoid any bubbles forming. Once the gel was solidified and looked opaque, the comb was removed, and the gel was placed into the electrophoresis chamber. 1X TBE buffer was added until the entire chamber was submerged and there was about 2-3 mm of buffer on top of the gel. Once the PCR tubes were done digesting, they were centrifuged for 5 seconds and 3 microliters of 10X loading dye was added to each tube. Then 6 microliters of the dye wa added to the uncut DNA samples of two individuals and 10 microliters of this were placed in wells 2 and 7. Well 1 was loaded with 10 microliters of the DNA size ladder (Grewe, B., McAllister, B., & El Zawily, A. 2023). Lastly, wells 3-6 were loaded with 10 microliters of each individuals digested PCR DNA. The lids were

6 placed onto the chambers with the power supply on, and they ran for 30-40 minutes. Once the gels were done, they were photographed with the Fotodyne system that shined UV light through, making them more easily identifiable. The photographs were then used to determine each individual's genotype by counting band sizes and comparing these fragments with the size ladder in well 1 (Grewe, B., McAllister, B., & El Zawily, A. 2023). The Hardy Weinberg equations were used to calculate the class alleles frequencies, p+q=1, and the expected class genotype frequencies, p^2+2pq+q^2=1, where p is the number of dominant alleles and q is the number of recessive alleles. Finally, we used the Chi-square test to see if our observed genotype frequencies fit into that of a Hardy Weinberg equilibrium population to be able to either reject or accept our null hypothesis. III. Results Figure 1. – Gel electrophoresis sample for the LCT gene. Well 1 (M) is DNA size ladder, well 2 and well 7 (U) is uncut DNA sample from lab members, wells 1-4 is sample cut DNA from each lab member. The bp (base pair) length is measured on a 50 to 766 scale where 50 is the lowest band and 766 is the highest under Well 1 (M). Figure 1 labeled above is a photograph of the amplified DNA samples used in the analysis of the LCT locus. The possible genotypes for this locus were TT (homozygous dominant), CT (heterozygous), CC (homozygous recessive). Different band lengths correspond to each genotype. For CC, there should only

Your preview ends here

Eager to read complete document? Join bartleby learn and gain access to the full version

Access to all documents
Unlimited textbook solutions
24/7 expert homework help

7 be one visible band of 386bp in length. For the TT genotype, there should be two visible bands, one of 238bp and another of 148bp in length. Lastly, the CT genotype should be both of of these together, since this genotype is both of the alleles. There should be 3 bands visible, one at 386bp (for the C allele), another at 238bp, and the last one at 148bp (representing the T allele). The two uncut samples, in wells two and seven, served as the control lanes because it shows what the amplified DNA would have looked had the restriction enzyme digestion not taken place. Since the T allele was not treated with the restriction enzyme, it was not cut at the BsmF1 site, meaning that it would show the same bp length as the t allele, 303, which is why there is one band in both of the uncut DNA wells of 303bp. For student 1, there is three bands visible indicating a CT genotype meaning that this person is heterozygous for this gene, and since lactose tolerance is the dominant allele, they are lactose tolerant. For student 2, there are two bands visible showing a TT genotype. TT is homozygous recessive genotype for this allele, meaning that they are lactose intolerant. Student 3’s well shows one band at the 386 bp length, yielding a CC genotype. The CC genotype is homozygous dominant attributing to lactose tolerance in this individual. Finally, student 4 has three bands, showing a CT genotype meaning lactose tolerant. Figure 2. – Gel electrophoresis sample for the TAS2R38 gene. Well 1 (M) is DNA size ladder, well 2 and well 7 (U) is uncut DNA sample from lab members, wells 1-4 is sample cut DNA from each lab member. The bp (base

8 pair) length is measured on a 150 to 766 scale where 150 is the lowest band and 766 is the highest under Well 1 (M). Figure 1 pictured above is a photograph of the TAS2R38 DNA fragmentation used for the analysis of each students’ genotype. The genotype options for this locus are TT (homozygous dominant), Tt (heterozygous), and tt (homozygous recessive). There are two bands that correspond to TT genotype, and they are located at 238bp and 65bp in length, but since the DNA scale does not go below 150bp, the 65bp band length is not visible on the gel. Considering this, a student with this genotype would have only one band of 238bp and be a taster of PTC. For the tt genotype, there is one visible band of 303 bp, and since they are both recessive, a person with this genotype would be a non-taster. And for Tt, similar to the LCT locus, these bands would all be present for a total of 3 bands, with only two of them being visible. One band would be of 303bp (representing t allele) and then there would be one band of 238pb (for T allele), there would also be a band of 65bp, but this is not visible. Therefore, a student with this genotype would have one band at 303bp and another band at 238 bp, indicating tasting of PTC. The two wells labeled ‘U’ correspond to the uncut DNA of the lab members, meaning that the t allele was not cut at the Fnu4H1 site (no restriction enzyme digestion), so it is the same length at the T allele which is why there is only one band visible of 303bp. For students one, three and four, there are two bands visible, one of 303bp and another of 238bp, indicating a genotype of Tt which would make these individuals tasters of the PTC bitterness. Student 2’s well shows one band that is visible at 303bp signifying a genotype of tt which would make this student a non-taster. Pooled data and calculations:

9 Table 1. – above is a table depicting the pooled class data of the observed genotype and phenotype of the LCT locus. Table 2. – above is a table depicting the pooled class data of the observed genotype and phenotype of the TAS2R38 locus. Table 3. – the table above shows the calculated allele frequencies of both the LCT and TAS2R38 loci using the Hardy-Weinberg model. The table also shows the genotypes frequency of each locus, as well as the observed and expected number of individuals. Table 4. – the table above shows the Chi-Square values obtained, for both the LCT and TAS2R38 loci, to determine the statistical significance. Tables 1 and 2 show the pooled data collection of all students who participated and indicates whether they were lactose tolerant or intolerant (LCT), or whether they were tasters or non-tasters (TAS). Table 3 shows both the allele and genotype frequencies of both the LCT and TAS2R38. To calculate this, the Hardy Weinberg equilibrium was used to obtain the allele and genotype frequency had the

Your preview ends here

Eager to read complete document? Join bartleby learn and gain access to the full version

Access to all documents
Unlimited textbook solutions
24/7 expert homework help

10 population fallen within the five assumptions required: no mutation, random mating, no gene flow, infinite population size and no selection. Table 3 indicates a contrast between the two loci and there expected and observed values. The TAS2R38 expected and observed values were relatively close compared to the drastic difference between observed and expected values of the LCT locus. In table 4 the Chi-Square analysis test was used determine if the variation between the expected and observed values for both loci were statistically significant enough to fall within Hardy-Weinberg equilibrium. The obtained p-value is the determining factor of this which is located in the farthest right column. For the LCT locus the p-value is 22.2 which falls well below the 0.05% mark meaning that it is significant; thus, the null hypothesis is rejected. This data shows that evolutionary forces have acted upon this locus and natural selection has occurred. The TAS2R38 p-value is shown to be 3.3 which falls between 15% and 20% signifying that it is not significant; thus, the null hypothesis is accepted. Here, the data shows that the alleles of this locus are steady within the Hardy Weinberg equilibrium and evolutionary forces have not acted on them. IV. Discussion The objective of this experiment was to be able to understand genetic variation and learn how scientists identify changes over time and how they measure them. The experimental objects included DNA extraction, successful PCR amplification, restriction enzyme digestion, and being able to use formulas and statistical analysis to be able to accept or reject our null hypothesis. Our results showed that our experimental hypothesis was accepted for the TAS2R38 locus but not accepted for the LCT locus. These conclusions were drawn from the Chi-Square test that was done where the p-values revealed the significance of the deviations between our observed and expected values for each loci. The statistical significance of the deviations rejected the null hypothesis, and a lack of significance would accept the null hypothesis. The null hypothesis was that both loci would fall under Hardy Weinberg but our data showed that this was true for only one of the loci, TAS2R38. Evolutionary forces that can play a role in a change in genotype frequencies within a population include natural selection, genetic drift and gene flow. In a more

11 fixed population, natural selection would most likely cause the most changes within genotype frequencies because it will favor whichever genotype will result in survival of the organism. Genetic drift would be considered the opposite of natural selection, as it is random chance change to a gene variant, similar to SNPs. Although within our population, gene flow is more likely the causal factor of discrepancies within our genotype frequencies of both loci. This is because all students within the class come from many different linages across the world. Humans are believed to have evolved from ape-like ancestors and so to test the evolutionary changes of PTC sensitivity, R. A. Fisher conducted the Edinburgh experiment where he concocted various PTC concentration solutions: 0, 6 ¼, 50, or 400 parts per million (Wooding, 2006). He presented these solutions to eight chimpanzees, and, after observing their distinct reactions to the bitterness, he concluded that six of the eight could taste the bitterness of the PTC. The results concluded that the taster and non-taster alleles were present at a 50:50 frequencies which was strikingly similar to the frequency within humans (Wooding 2006). This means that the genotype frequencies have been maintained for millions of generations meaning that the T and t alleles frequencies have not deviated out of Hardy Weinberg equilibrium which is a direct correlation to the results obtained from the experiment that was conducted. This explains why our null hypothesis for TAS2R38 was accepted. In another study, an experiment was conducted among six different populations of Muslims in Jammu (Fareed, Mohd, et al. 2012). They observed that within all populations there was a higher frequency of tasters to nontasters. This directly matches our data on the genotype frequency, and this is due the the taster allele (T) being the dominant trait. This is the only aspect of this experiment that confirms the obtained data. They also compared the frequency of tasters between males and females and found that females had more PTC tasters than males (Fareed, Mohd, et al. 2012). In the case of the lactose intolerance and its evolutionary path, A group of scientists conducted an experiment where they used polymorphic microsateillite markers that would flank the LCT region, exposing the presence of the variant causing lactose intolerance: LCT-113910C>T (Matter, Rejane, et al. 2012). After testing a tremendous amount and variation of population spanning across the world, they concluded that lactose intolerance was a random mutation must have occurred in a region above the LCT allowing people who have the lactose

12 persistence allele to be phenotypically expressed (Mattar, Rejane, et al. 2012). This study is a good description so to why the LCT locus didn’t fit into Hardy Weinberg Equilibrium. If lactose intolerance appeared randomly random mutations, it is safe to assume that these random mutations would continue to happen meaning that the LCT locus is consistently changing or, in other words, evolving. Since the alleles are not fixed, this genotype would not fit into Hardy Weinberg Equilibrium. In another study, a group of scientists performed an experiment looking at hypoclactasia/lactase persistence within different Brazilian populations (Mattar, Rejane, et al. 2009). These populations varied among race and age. They performed the experiment by extracting DNA from leukocytes and using PCR amplification of the DNA and RLFP analysis (Mattar, Rejane, et al. 2009). They found that the CC genotype for lactose resistance among Brown groups of people were significantly higher with Black Brazilians at 80% and Japanese Brazilians at 100%. In these populations, the lactose intolerance is the dominating trait, despite being a recessive allele (Mattar, Rejane, et al. 2009).

Your preview ends here

Eager to read complete document? Join bartleby learn and gain access to the full version

Access to all documents
Unlimited textbook solutions
24/7 expert homework help

13 V. References Fareed , Mohd, et al. “Genetic Study of Phenylthiocarbamide (PTC) Taste Perception among Six Human Populations of Jammu and Kashmir (India).” Egyptian Journal of Medical Human Genetics , Science Direct, 3 Mar. 2012, www.sciencedirect.com/science/article/pii/S1110863012000043#:~:text=Genotype %20frequency%20among%20different%20human%20populations%20for%20PTC %20tasting.&text=The%20chi%2Dsquare%20(χ2)%20values%20for%20genotype %20frequencies,six%20populations%2C%20are%20significant%20statistically. Grewe, B., McAllister, B., & El Zawily, A. (2023). “Project 3: Investigating Genetic Variation in Populations.” BIOL 14ll Laboratory Manual. Macmilliam Learning Curriculum Solutions. Mattar , Rejane, et al. “Lactose Intolerance: Diagnosis, Genetic, and Clinical Factors.” Clinical and Experimental Gastroenterology , U.S. National Library of Medicine, 5 July 2012, pubmed.ncbi.nlm.nih.gov/22826639/. Mattar, Rejane, et al. “Frequency of LCT -13910C>T Single Nucleotide Polymorphism Associated with Adult-Type Hypolactasia/Lactase Persistence among Brazilians of Different Ethnic Groups - Nutrition Journal.” BioMed Central , BioMed Central, 2 Oct. 2009, nutritionj.biomedcentral.com/articles/10.1186/1475-2891-8-46. Wooding, Stephen. “Phenylthiocarbamide: A 75-Year Adventure in Genetics and Natural Selection.” Genetics , U.S. National Library of Medicine, Apr. 2006, www.ncbi.nlm.nih.gov/pmc/articles/PMC1456409/.

Lab Report 3 Bio 1

Related Documents