Lab Report 3 Bio 1

.docx

School

University of Iowa *

*We aren’t endorsed by this school

Course

Subject

Biology

Date

Apr 3, 2024

Type

docx

Pages

Uploaded by AmbassadorMetal7079

1 Investigating Genetic Variation among the LCT and TAS2R38 Loci Bethel Tewabe Lab Section: 0A29 Team Members: Colten Kuhn, Ashley Jokovich, Gavin Smith 11/26/2023 I. Introduction

2 The overall objective of project 3 was to understand genetic variation as well as understand how scientists identify and measure these differences. The theory of evolution was first discussed in a series of experiments performed by Charles Darwin where he concluded that species evolved through natural selection. Although a pivotal moment in science, it did not explain how this occurred. Mendel’s experiments with pea plants yielded the discovery of various allele traits and how they could present, the most known ones being the dominant and recessive. Putting together the work of Charles Darwin and Mendel, Godfrey Hardy and Wilhelm Weinberg discovered two mathematical equations that could show frequencies of these two allele traits and how they present within a specific population, thus, explaining how/if it changes over time. These equations will be further discussed and implemented in the Results section. As far as gene variation, there are many different ways that they can occur, but the most prevalent way is through single nucleotide polymorphism, also called SNPs. SNPs occurs when a single nucleotide in a sequence is different from the norm of the population and this difference causes variations in how specific aspects are phenotypically expressed and/or how they are perceived similar to the LCT and TAS2R38 gene variation that was investigated in this experiment. The LCT gene is located on the second chromosome and determines whether an individual would be lactose tolerant or lactose intolerant. This gene encodes for the enzyme lactase, used in catalyzing the breakdown of the disaccharide lactose, which is the most prominent sugar in milk and dairy products, into its hydrolyzed monosaccharides, glucose and galactose. These monosaccharides would then be absorbed by the cells of the small intestine to be carried through the circulatory system to be disbursed among all the cells of the body to be used as an energy reserve (Grewe, B., McAllister, B., & El Zawily, A. 2023). This is what would occur within individuals with the LCT gene that codes for the lactase enzyme. In those who are lactose intolerant, LCT gene does not code for the lactase enzyme, the lactose disaccharide would not be broken down into its monosaccharide forms needed for absorption but would instead carry on as a whole into the colon and be fermented by the bacteria that reside there. This can cause all or some of these digestive symptoms: cramping, bloating, flatulence and diarrhea (Grewe, B., McAllister, B., & El Zawily, A. 2023).

3 TAS2R38 gene is located on the seventh chromosome. It encodes for the presence of a protein that allows for some individuals to taste the bitterness of PTC and some individuals to not. PTC sensitivity was first recognized in the early 1930s when a scientist, Arthur L. Fox, was pouring some of the PTC powder into a separate bottle and some particles got wafted into the air. Another scientist, C.R. Noller, who was within the vicinity inhaled some of this powder and complained about the bitterness, yet Fox insisted the powder tasted like nothing. After taking turns tasting the powder, they both realized how distinctly different they biologically reacted to the powder. Because of this, Fox decided to test this power on a larger population of people and discovered that distinct variations existed among differences in ethnicity, sex and age. As well as there were more tasters in comparison to non- tasters (Wooding, 2006). Today, PTC tasting has been vastly tested and studied among geneticists and curious biology students. The specific objectives of this experiment were successful DNA extraction, utilizing PCR (polymerase chain reaction) to amplify certain segments of the DNA, and lastly to investigate the chosen loci and how those loci will be distinguished (Grewe, B., McAllister, B., & El Zawily, A. 2023). We hypothesized that LCT and TAS2R38 will not be Hardy Weinberg, meaning that they are still evolving, because the condition of no gene flow would be violated in both cases. The null hypothesis, that both loci will fit Hardy-Weinberg, will be the one used in this experiment to, in the end, be able to accept or reject our experimental hypothesis. To achieve these objectives, the experiment was broken up into two labs. The first one covering DNA extraction and PCR amplification and the second one tackling restriction fragment length polymorphism (RFLP) analysis by using a gel electrophoresis. During the first lab, each individual swabbed the inside of their cheeks to grab epithelial cells. From these cells, DNA was extracted by placing the swabs in DNA extraction solution the tube in 65 °C water and 98 °C water with vortexing for 10-15 seconds in between. Next, the DNA was amplified through PCR with the use of forward and reverse primer mixes to exponentially copy the DNA. During our second lab, we added in restriction enzyme cocktails that were specific to each gene and the extracted DNA into tubes and incubated them for 45-60 minutes. Then, uncut DNA and PCR DNA was placed into a gel electrophoresis chamber which would show the DNA band sizes and length allowing determination

4 of genotypes. Lastly, the Hardy Weinberg Equilibrium and Chi squared statistical analysis was used to either reject or support the null hypothesis. II. Materials and Methods (2 pages maximum) At the beginning of Wet lab 1, the class taste tested a strip of PTC paper, and the results were recorded. Students that experienced an extremely bitter taste were reported as tasters (T) and students who experienced no taste at all were recorded as non-tasters (t). There was also another category of students who could taste the bitterness, but not as strong as the tasters, that were labeled partial tasters (PT). Following this, students obtained a template DNA strand by swabbing the inside of both cheeks approximately 20 times, collecting epithelial cells (Grewe, B., McAllister, B., & El Zawily, A. (2023). The DNA extraction was performed by placing the swab in a PCR tube containing DNA extraction solution. The swabs were rotated 10 times and then placed on the vortex for 10 seconds and incubated in 65°C water for one minute. Once that was done, the tube was placed on the vortex for another 15 seconds and, again, the tubes were submerged in 98°C water for 2 minutes. Finally, the tube was placed on the vortex for another 15 seconds, and then allowed to cool to room temperature before being put into a cup of ice (Grewe, B., McAllister, B., & El Zawily, A. 2023). The next step was performed to set up the PCR tube of the target loci, LCT and TAS2R38. In order for the PCR amplification to be successful, each tube needed to consist of three things. The first being a 0.2 ml PCR master mix which contained Taq DNA polymerase, the four deoxyribonucleotides, and required buffer and salts (Grewe, B., McAllister, B., & El Zawily, A. 2023). Second, the DNA sample. Third, a specific primer mix for each locus. Listed below are the primers used for the target loci, each were used at 500nM concentration: LCT target loci primers:  LCT-F primer sequence: 5’ GTTGAATGCTCATACGACCAT 3’  LCT-R primer sequence: 5’ TGCTTTGGTTGAAGCGAAGA 3’ TAS2R38 target loci primers:  TAS2R38-F primer sequence: 5’AACTGGCAGATTAAAGATCTCAATTTAT3’  TAS2R38-R primer sequence: 5’AACACAAACCATCACCCCTATTTT3’ Each PCR tube already contained 0.2 ml of the PCR mix, so to each, 20 microliters of the primer mix was added, and 5 microliters of the DNA sample was added. Before loading into the Thermocycler, the tubes were centrifuged briefly for

5 ~5 seconds (Grewe, B., McAllister, B., & El Zawily, A. 2023). Next the tubes, for both LCT and TAS2R38, were cycled 40 times for 30 seconds and two different temperatures. The first temperature was 95°C, this was to completely denature all of the DNA. Then at 55°C, which was for annealing the DNA and primers. Lastly, the thermocycler was set to 72°C for 5 minutes to complete the synthesis of the new DNA (Grewe, B., McAllister, B., & El Zawily, A. 2023). Once PCR tubes were obtained, they were treated with restriction enzymes, which cleave the DNA of one of the alleles, so that the two alleles can be distinguished from one another. For the LCT locus, 10 µl of the restriction enzyme cocktail containing BsmF1 was pipetted into the PCR tube, with 5 µl of sterile water, and 5 µl of the PCR DNA. The LCT tubes were then centrifuged for ~5 seconds and then placed in a 65°C water bath for 45-60 minutes. The exact same was done for the TAS2R38, except the restriction enzyme for this locus was Fnu4H1, and the tubes were incubated in a 37°C water bath. Leftover contents in the LCT and TAS2R38 tubes were kept for uncut samples to be used in the gel electrophoresis analysis. In the last part of our wet lab, two gels were created. A 40 ml of a 1.6% agragose solution was needed, so after doing to math, it was concluded that 0.64 grams of agragose was necessary. The agragose was added to an Erlenmeyer flask with 40 ml of 1X TBE (1X Tris/Borate/EDTA) buffer, and this was mixed together. The solution was microwaved on high power for 1 minute, until boiling. Once the agragose was cooled, ethidium bromide was added. This is a mutagenic agent that inserts itself into the DNA like a base pair to stain the DNA fragments as they move through the gel (Grewe, B., McAllister, B., & El Zawily, A. 2023). The flask was swirled and then poured into the gel tray, careful to avoid any bubbles forming. Once the gel was solidified and looked opaque, the comb was removed, and the gel was placed into the electrophoresis chamber. 1X TBE buffer was added until the entire chamber was submerged and there was about 2-3 mm of buffer on top of the gel. Once the PCR tubes were done digesting, they were centrifuged for 5 seconds and 3 microliters of 10X loading dye was added to each tube. Then 6 microliters of the dye wa added to the uncut DNA samples of two individuals and 10 microliters of this were placed in wells 2 and 7. Well 1 was loaded with 10 microliters of the DNA size ladder (Grewe, B., McAllister, B., & El Zawily, A. 2023). Lastly, wells 3-6 were loaded with 10 microliters of each individuals digested PCR DNA. The lids were

Your preview ends here

Eager to read complete document? Join bartleby learn and gain access to the full version