6_Proj

docx

School

Northeastern University *

*We aren’t endorsed by this school

Course

2301

Subject

Biology

Date

Apr 3, 2024

Type

docx

Pages

Uploaded by KidBeeMaster1068

Projects Six and Seven: Cloning (15 points) In this two-part project you will explore the basic principles of cloning including primer design and finding compatible restriction enzyme sites between a cloning vector and an insert. These are widely used techniques in molecular biology labs. Please view the following videos to answer the first five questions before class: Sticky endz DNA cloning and recombinant DNA Primer design I. Questions based on the introductory videos (5 pts) 1. What is the ideal length of a primer (give a range)? The ideal length of a primer is between 18 and 24 bp. 2. What is the maximum recommended difference in melting temperature between two primers? The maximum recommended difference in melting temperature between two primers is 5 degrees Celsius. 3. What is a "GC anchor"? A “GC anchor” is something used to stabilize base pairs in the presence of guanine or cytosine bases in the last 5 bases of a PCR primer and that enhances primer specificity to the complementary sequence. 4. How are bacteria prompted to take up a plasmid? Bacteria are prompted to take up a plasmid by putting them in the presence of the plasmid and giving it a heat shock. 5. What are "sticky ends" and why are they useful in cloning? The “sticky ends” are DNA fragment strands that want to rejoin. They have sections that overlap and bases that attach, which increases the likelihood for rejoining complementary base pairs, making them helpful in cloning. II. Cloning (5 pts) 6. When the plasmids are mixed with the bacteria, not all of the "bugs" will take up plasmids. How do you ensure that the bacterial colonies that you grow on an agar plate are from bugs that took up the plasmid? You can ensure that the bacteria you grow on the agar plate are from bugs that took up the plasmid by placing an antibiotic resistance gene. This will allow the colonies from bugs to only survive. Your patient has a mutation in the beta subunit of hemoglobin (gene name: HBB ). The patient's genomic sequence from this region is posted on Canvas ("pt_HBB"). 7. Learn more about the HBB gene by searching for it in the "Gene" database on the NCBI site. Based on the information in the entry, what disorders could result from a mutation in this gene? Sickle cell anemia

Cloning plasmids have been engineered to allow you to insert a gene sequence into the plasmid, then replication the plasmid in bacteria. Some of these plasmids can also be introduced into mammalian cells (in culture) where the gene you inserted can be expressed. Such plasmids are known as mammalian expression plasmids. You want to clone the wild-type HBB gene and the mutant gene from your patient separately into a mammalian expression plasmid to analyze expression in mammalian cells. For cloning you use a cDNA version of the processed mRNA sequence so that the sequence will fit into the cloning vector (introns take up a lot of space!) and because splicing occurs in the nucleus, but your plasmid will be introduced into the cytoplasm. Let's take a look at the wild-type mRNA sequence for human HBB .  Scroll down the Gene page to the NCBI RefSeq section.  Locate the "mRNA and Protein(s)" section and click on the link for GenBank accession number NM_000518.5 ("NM" indicates mRNA, and "NP" indicates protein). Note that the RefSeq mRNA sequence is already in cDNA format (notice the lack of uracil) so we can use this sequence as the template to which we'll design our special primers. 8. Copy and paste the full mRNA sequence here, in FASTA format (you can use the FASTA link on the top left of the page): >NM_000518.5 Homo sapiens hemoglobin subunit beta (HBB), mRNA ACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACCATGGTGCATCTGACTCCTGA GGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGC AGGCTGCTGGTGGTCTACCCTTGGACCCAGAGGTTCTTTGAGTCCTTTGGGGATCTGTCCACTCCTGATG CTGTTATGGGCAACCCTAAGGTGAAGGCTCATGGCAAGAAAGTGCTCGGTGCCTTTAGTGATGGCCTGGC TCACCTGGACAACCTCAAGGGCACCTTTGCCACACTGAGTGAGCTGCACTGTGACAAGCTGCACGTGGAT CCTGAGAACTTCAGGCTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCATCACTTTGGCAAAGAATTCA CCCCACCAGTGCAGGCTGCCTATCAGAAAGTGGTGGCTGGTGTGGCTAATGCCCTGGCCCACAAGTATCA CTAAGCTCGCTTTCTTGCTGTCCAATTTCTATTAAAGGTTCCTTTGTTCCCTAAGTCCAACTACTAAACT GGGGGATATTATGAAGGGCCTTGAGCATCTGGATTCTGCCTAATAAAAAACATTTATTTTCATTGCAA The expression vector that you want to clone your gene into is called pFLAG-CMV-1 . Plasmid vectors have what are called multiple cloning sites (MCSs): short stretches that have been designed to have many different restriction enzyme (RE) recognition sites, like multiple adaptors that can fit a wide range of possible inserts.  Look at the vector map (click on the pFLAG link above, and scroll down to the circular diagram). Mouse over the blue box representing the multiple cloning site . 9. What is the nucleotide position range of the MCS (mouse over it to see)? 991 … 1057 = 67 bp Now you'll want to see if the HBB mRNA sequence from NCBI happens to have any RE sites that match in the upstream/downstream region from the coding sequence.  Copy and paste the mRNA sequence into the NEB cutter site . Leave settings at default parameters and hit submit. 10. List four enzymes that cut upstream or downstream of the ORF, which is represented by the grey arrow along the top of the linear map: Bfal, Msel, Bmrl, and Tfil

III. Primer design (5 pts) Since none of the RE cut sites match between the HBB mRNA sequence and the plasmid vector (pFLAG-CMV-1), we'll need to get creative. One solution is to design each primer to include the cut site we want at the 5' end. The extra nucleotides that make up the cut site will not hybridize to the template, but they'll be copied in the newly synthesized strands. After PCR, our amplicons will then include: RE cut site + primer sequence + sequence-of-interest + primer sequence + RE cut site. This type of PCR strategy is common, letting us add various useful motifs adjacent to the sequence-of-interest during amplification.  Start at the homo sapiens hemoglobin subunit beta (HBB) mRNA page here.  In another browser tab, open the identical page for reference.  On the right-hand side of the webpage find the section called “Analyze this sequence” and select the “pick primers” link. This will bring you to the page “Primer-BLAST” and will automatically place the accession ID for HBB into the PCR template box.  We'll need to fill out the "Range" to indicate the region we want to amplify, which is the coding sequence (CDS). Locate the CDS section among the features on the left side of the GenBank page you have open in another tab. You will notice the range is 51..494. Click on the “CDS” link, which will bring you to the bottom of the GenBank page and reveal the highlighted CDS range. 11. What is the sequence of the start codon and its position for this transcript? The sequence of the start codon is atg and it is position 51-53 for this transcript. 12. What is the sequence of the stop codon and its position? The sequence of this transcript is taa and its position is 491-494. 13. Based on what you know about mRNA, the transcript will include sequences just upstream of the start codon and just downstream of the stop codon. What are these upstream and downstream sequences known as? The sequences that are downstream of the mRNA sequence would be the initiation and 5’ UTR regions and the sequences upstream would be the terminator and 3’ UTR regions.  On the primer-BLAST page, for the forward primer range, select the first 50 positions before the start codon. For the reverse primer, select the 50 positions immediately after the stop codon.  Leave the default parameters and click “Get Primers”. It might take a while to compute so be patient.  The results will be displayed as a graphical summary and also detailed primer reports. Use the detailed primer reports to answer the following question. 14. Choose primer pair 1 and write the sequence of each primer in the 5’ to 3’ direction. Example: 5'GCCTATTAGATAGC3' Forward primer: 5’ AGCAACCTCAAACAGACACC3’ Reverse primer:5’ ATTGGACAGCAAGAAAGCGA3’

Your preview ends here

Eager to read complete document? Join bartleby learn and gain access to the full version

Access to all documents
Unlimited textbook solutions
24/7 expert homework help

15. According to the primer report, how long is the product of a PCR reaction using these primers expected to be? According to the primer report, the product of a PCR reaction using these primers is expected to be 486 bp.

Related Documents

FA16_Student_Intro_to_Inverst Lab Sheet-1.docx

FA19_Student_Protista and Fungi Lab Sheet.docx

Unit2A Problem Set (1).pdf

8.12 Radish Seed lab-LD only-2.pdf

Projects Six and Seven.docx

Zoology Lab Tutorial Assignment.docx

MCCG150 Week 5 Initial Discussion post.docx

Recommended textbooks for you

Biochemistry

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Cengage Learning

Human Heredity: Principles and Issues (MindTap Co...

Biology

ISBN:9781305251052

Author:Michael Cummings

Publisher:Cengage Learning

Comprehensive Medical Terminology

Nursing

ISBN:9781133478850

Author:Jones

Publisher:Cengage

Case Studies In Health Information Management

Biology

ISBN:9781337676908

Author:SCHNERING

Publisher:Cengage

Biology (MindTap Course List)

Biology

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Cengage Learning

Biology 2e

Biology

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:OpenStax

SEE MORE TEXTBOOKS

Recommended textbooks for you

Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Comprehensive Medical Terminology
Nursing
ISBN:9781133478850
Author:Jones
Publisher:Cengage
Case Studies In Health Information Management
Biology
ISBN:9781337676908
Author:SCHNERING
Publisher:Cengage
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax