Pierce_Gene to Protein_Handout

PLEASEE HELP ME

Number 7 please

Please help with this genetic mutation problem (cellular bio)

QUESTION: Transcribe the gene. Write out the correct sequence of m RNA bases. Notice that this is the same gene as in B above. Recall that in RNA, thymine (T) does not exist and uracil (U) takes its place. 3' ССА TAG CÁC CTT GTC ACA ACG TGT TCG TAG ACA 1 3. 4. 6. 7. 8. 9- 10 11 AGG AAC АТА ATA GTT AAC CTT TTG ATA ACA ТТА ACT 12 13 14 15 16 17 18 19 20 | 21 in

None

Molecular Biology (Biol-L211) Dr. Nole Central Dogma Practice - Processes The general flow of genetic information is diagrammed below. Think carefully about what type of molecule is represented by each item in the diagram and clearly address each of the following. A. Label each structure as mature mRNA, pre-mRNA, protein, or DNA. B. Label each arrow to indicate which is processing, transcription, replication, and translation. C. Identify the general location (on the appropriate molecule) of the promoter sequence and the terminator sequence. D. Identify the specific location of the place where the start codon and stop codon function most directly. E. Where does RNA polymerase bind to begin transcription? F. Where specifically does the ribosome bind to begin translation-i.e., what are the ribosome binding sites and where are they found? G. Label each end of the mature mRNA and the polypeptide to correctly specify polarity. (You should use the labels 3', 5', C-terminus, and N-terminus.)

Molecular Biology (Biol-L211) Dr. Nole Central Dogma Practice - Processes The general flow of genetic information is diagrammed below. Think carefully about what type of molecule is represented by each item in the diagram and clearly address each of the following. A. Label each structure as mature mRNA, pre-mRNA, protein, or DNA. B. Label each arrow to indicate which is processing, transcription, replication, and translation. C. Identify the general location (on the appropriate molecule) of the promoter sequence and the terminator sequence. D. Identify the specific location of the place where the start codon and stop codon function most directly (i.e., which molecule is actually translated?). E. Where does RNA polymerase bind to begin transcription? F. Where specifically does the ribosome bind to begin translation-i.e., what are the ribosome binding sites (in both prokaryotes and eukaryotes) and where are they found? G. Label each end of the mature mRNA and the polypeptide to correctly…

Follow instructions fill out 2nd row circle stop codons

Two amino acids in the chain are different colors than the rest. Based on how the polypeptide moves, do you think they are (hydrophobic or hydrophilic)? Circle your answer.

You continue to study the expression of the hexose kinase gene and capture the following electron micrograph of the gene being expressed. MRNA 1 20 ORI 40 60 TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGIAATATĞGGGATGCACTATC 5' 3' AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCA'NTATAÇCCCTACGTGATAG CACTATC promoter RNA polymerase ribosome

Help me please

Write TRUE or FALSE. If false, write the word/s that make(s) the statement incorrect. 1.Telomeres are coding repeated DNA sequences at the end of the chromosome. 2. The anticodon sequence AGT can be found in tRNA.

ANSWER THIS; Click Edit DNA and make a substitution mutation that changes the first base (C) in the second codon to an A. Ø  What effect does this mutation have on the polypeptide? Compare to the original polypeptide. 

Mutated DNA Sequence #3 TACAC CT TAG C GACGACT... What's the mRNA sequence? (Circle the change) amino acid sequence? Will there likely be effects? What type of mutation is this?

pen+ GEAR Normal DNA Normal RNA Amino Acids Mutant DNA Mutant RNA: Name: FRAMESHIFT MUTATIONS occur when a base is added (or removed) from 8. Determine the amino acid chain coded for by the following sequence. Supp another A is added after the first codon. Complete the chart showing the amir normal and mutant sequence. Amino Acids Investigation: DNA. Proteins. and Mutatic TGG AGT CGA GGT TGG AAG TCG AGG T Why are frameshift mutations likely to cause more problems than a p 9. Cystic fibrosis is a disease that causes mucus to build up in th misshapen protein in the cell membrane which interferes with the popociated with the disorder

I struggled with my homework. Can you help me, please?

Read instrxutions and complete MRNA CODON TABLE.

If a gene for a polypeptide has a mutation that causes an amino acid change but the new amino acid has very similar properties (e.g. non-polar amino acid substituted for another non-polar amino acid), then it is likely this mutation will have no effect on the function of the protein and will be termed a neutral mutation. O True False

BamHI cut sequence: G//GATCC and each sequence is 250 nucleotides long. How many DNA segments would be created by cutting the normal gene with BamHI?

Read instructions and read amino acids at position 6 Column show work

Cynt Classifying mutations A certain section of the coding (sense) strand of some DNA looks like this: $-ATGTATATCTCCAGTTAG-3" It's known that a very small gene is contained in this section. Classify each of the possible mutations of this DNA shown in the table below. mutant DNA 5- ATGTATCATCTCCAGTTAG-3' S-ATGTATATCTCCAGTTAG-3 5- ATGTATATATCCAGTTAG-3' type of mutation (check all that apply) insertion deletion point silent noisy insertion O deletion point silent noisy insertion O deletion point silent Onoisy X G

Sickle-cell hemoglobin differs from regular hemoglobin in just one amino acid. Normal hemoglobin is created from the codon GAA, which codes for glutamic acid while sickle-cell hemoglobin has the codon GUA, which codes for valine. This is an example of what type of mutation? * O Insertion O Silent mutation O Deletion O Substitution mutation

7.  F. State if/how Remedios' mutation changes the amino acid sequence and describe the effect that change has, if any, on the protein.

2ith the diagram provided please write the polypeptide. sequence obtained from the translation of the black allele gene

???????

None

Use this mRNA coding sequence as your starting point. This sequence begins with a start codon and ends with a stop codon, so it is only looking at the region of DNA that directly encodes a protein sequence. 5’-AUGCACAAAUUAGAGUACCCCCCAGGAAGGUAG-3’ Make the following mutation in this sequence by changing/adding/removing only one nucleotide. Make the mutation easy to see (a different color, circled, something like that) 1) A silent mutation that is also a transition

Use this mRNA coding sequence as your starting point. This sequence begins with a start codon and ends with a stop codon, so it is only looking at the region of DNA that directly encodes a protein sequence. 5’-AUGCACAAAUUAGAGUACCCCCCAGGAAGGUAG-3’ Make the following mutation in this sequence by changing/adding/removing only one nucleotide. Make the mutation easy to see (a different color, circled, something like that) A missense mutation that is also a transversion

Use this mRNA coding sequence as your starting point. This sequence begins with a start codon and ends with a stop codon, so it is only looking at the region of DNA that directly encodes a protein sequence. 5’-AUGCACAAAUUAGAGUACCCCCCAGGAAGGUAG-3’ Make the following mutation in this sequence by changing/adding/removing only one nucleotide. Make the mutation easy to see (a different color, circled, something like that) A nonsense mutation

Use this mRNA coding sequence as your starting point. This sequence begins with a start codon and ends with a stop codon, so it is only looking at the region of DNA that directly encodes a protein sequence. 5’-AUGCACAAAUUAGAGUACCCCCCAGGAAGGUAG-3’ Make the following mutation in this sequence by changing/adding/removing only one nucleotide. Make the mutation easy to see (a different color, circled, something like that) A frameshift mutation

Neeed help:. . Fill out the following table, using wobble whenever possible

None