F59A6C5D-F231-4B44-8F5A-5EA370F70B38

.

School

Citrus College *

*We aren’t endorsed by this school

Course

105

Subject

Biology

Date

Jan 9, 2024

Type

Pages

1

Uploaded by CaptainViper3775

Report
Exam 3 Review Covers weeks 9-13 Use the following Non Template DNA strand to build ATATATAGGCGGATGTTTGGGAAACCCGAAGCAAGCTGTGTTIGAGTAGCAT 1) Complimentary Template DNA strand TATATATCCGCCTACAAACCCCTTTGGCTTCGTTCACACAACTCATCGTAA 2) mRNA strand UAUAUACCGCCUACAAAACCCCUUUGGCUCGCUUCACACAACUCAUCGUAA 3) Using the mRNA strand and the codon chart build the amino acid sequence for a protein UAU, AUA, CCU, GCU, ACA, AAA, CCC, UUU, GGC, UCG, CUU, CAC, ACA, ACU, CAU, CGU, AA Tyr - lle - Pro - Ala - Thr - Lys - Pro - Phe - Gly - Ser - Leu - His - Thr - Thr - His - Arg - AA (stop) What type of mutation (silent, nonsense, missense) would result if the underscored Thymine had been substituted with a Cytosine. ( Hint: get the DNA template, then build mRNA, then build amino acid sequence) ATATATAGGCGGATGTTTGGGAAACCCGAAGCAAGCTGCGTTGAGTAGCAT UAU, AUA, CCG, CCU, ACA, AAA, CCC, CUU, UGG, CUC, GCU, UCG, ACG, CAA, CUC, AUC, GUA, A Tyr- lle- Pro- Pro- Thr- Lys- Pro- Leu- Trp- Leu- Ala- Ser- Thr- GIn- Leu- lle- Val- A(stop) It would be a missense mutation, due the different amino acid in the protein sequence. What type of mutation (silent, nonsense, missense) would result if the underscored Adenine had been substituted with a Thymine ( Hint: get the DNA template, then build mRNA, then build amino acid sequence) ATATATAGGCGGATGTTTGGGTAACCCGAAGCAAGCTGTGTTGAGTAGCAT UAU,AUA,CCG,CCU,ACA AAA,CCC,AUU,UGG,CUC,GCUUCA, CACAACUCAUCGUAA 4 Define silent mutation It is a mutation that is not expressed. Nefine Miccence mittatinn
Discover more documents: Sign up today!
Unlock a world of knowledge! Explore tailored content for a richer learning experience. Here's what you'll get:
  • Access to all documents
  • Unlimited textbook solutions
  • 24/7 expert homework help