exs 8 Questions

.docx

School

University of Arkansas, Fayetteville *

*We aren’t endorsed by this school

Course

2531L

Subject

Chemistry

Date

Dec 6, 2023

Type

docx

Pages

3

Uploaded by MinisterPorcupinePerson987

Report
Questions: 1. You should note that the thermocycler has a heated lid that covers your tubes. Why do you think a heated lid is necessary? a heated lid prevents condensation in the top of the tube. 2. When designing the oligonucleotides for this experiment, it was determined that the Tm (melting temperature) of BlaF (oDM0318) and BlaR (oDM0319) was 61 o C and 64.6 o C, respectively. This knowledge is important for determining the annealing step? Explain how you define the annealing temperature and why? The annealing temperature is about 3-5 degrees below the the TM of the primers which allows the annealing of the DNA oligonucleotide primers to the single stranded DNA template. This eventually leads to DNA synthesis. 3. Looking at reagents contained in Master Mixes, can you define the purpose of each of those listed below. a. Deoxynucleotides: Building blocks from which the DNA polymerase synthesizes a new strand, dATP, dCTP,dCTP,dTTP b. Mg +2 : used by Taq Polymerase to carry synthesis of the new strands c. Taq polymerase: synthesizes the newly formed strands by adding bases complementary in A5 prime to three prime direction d. BlaF/BlaR: these allow each single strand DNA molecule to be read in the/ reverse direction left to right/right to left 4. The sequence of the oligonucleotides used for the PCR amplification of the Ampicillin resistance gene (Bla) are: 1. BlaF (oDM0318): 5’ GAGTATTCAACATTTCCGTGTCG 3’ 2. BlaR (oDM0319): 5’ CCAATGCTTAATCAGTGAGGCACC 3’ The sequence of the ampicillin resistance gene is shown below. Please highlight or underline where BlaF and BlaR are annealing to the DNA for amplification. Based on this knowledge, you should be able to predict the size of the amplified DNA fragment you will observe on the
agarose gel that you will run next week. What is the predicted size of the PCR product of the Bla gene? PCR fragment size is ____858_____ bp. Table 5: Data Table for the PCR reaction 1 2 3 4 Questions: Bands from PCR observed (top to bottom of gel) Distance migrated from the well (mm) Size of the bands in bp. 1 no bands 0mm 2 two bands 37mm, 64mm 1,000bp,500bp 3 three bands 17mm, 28mm, 38mm 4,000bp, 1,500bp, 1,000bp 4 1. How does the predicted size of the PCR product correlate with the size you measured in Table 5?
Your preview ends here
Eager to read complete document? Join bartleby learn and gain access to the full version
  • Access to all documents
  • Unlimited textbook solutions
  • 24/7 expert homework help