. The following synthetic polynucleotide is synthesized and used as a template for peptide synthesis in a cell-free system from E. coli. .AUAUAUAUAUAUAU-. What polypeptide would you expect to be produced? Precisely what information would this give you about the code?
Q: If you set up an in vitro translation reaction containing poly(ACGU), as template, which of the…
A: A three-letter codon is a sequence of DNA or RNA that corresponds to a specific amino acid. These…
Q: Using the genetic code, indicate which polypeptides would be synthesized if poly-UGG were used in a…
A: Polypeptides are the linera chain of Amino acids Synthesised according to the codons on mRNA.…
Q: Discuss the significance of modified bases within tRNA molecules.
A: There are four nucleotide bases present in DNA such as Adenine (A), Thymine (T), Guanine (G) and…
Q: 2. The following polynucleotide was synthesized and used as a template for peptide synthesis in a…
A: Since we answer only one question at a time, we are answering the first question listed here. Please…
Q: The genetic code was deciphered by experiments in which synthetic polyribonucleotides of known…
A: Hi dear, here's your answer.please like it .
Q: Determine the mechanism and base change(s) which resulted in the alteration of the sequence of a…
A: In genetics, the mechanism of base change is defined as the change or replacement of DNA single base…
Q: Biochemistry: Site-directed mutagenesis, in which individual amino acid residues are replaced with…
A: Enzyme activity is used to assess the catalytic activity of an enzyme. One enzyme unit (U) is the…
Q: Name the GREEN structure of the tRNA Variable loop D-loop Anticodon loop Pseudouridine loop
A: According to the messenger RNA (mRNA) nucleotide sequence, transfer RNAs (tRNAs), also known as…
Q: In describing the triplet binding assay, an undergraduate with limited knowledge of translation…
A: Every three nucleotides in a row count as a triplet in the genetic code and codes for a single amino…
Q: Briefly explain the importance of the 5'-cap in the translation process. Do not simply define the…
A: Introduction :- During transcription, the 5' cap is inserted to the first nucleotide in the…
Q: what percentage of the total amino acids in the protein would be made up of proline (Pro)?
A: Proline is an amino acid codded by the codons CCG, CCC, CCU, and CCA. Any one of these codons can…
Q: Look up a standard genetic code table, how many codons will be recognized by tRNA charged by…
A: Introduction A gene can be defined as sequence of bases that encodes a functional protein molecule.…
Q: . The genetic code is thought to have evolved to maximize genetic stability by minimizing the effect…
A: Arginine is coded by six mRNA codons.
Q: A group of researchers isolate 'Protein X' from the wall of a human stomach with the intent of…
A: The protein is an extremely complex substance which consist of amino acid residues jointed by…
Q: Consider the hypothetical serine protease, which shows the specificity pockets. The S, pocket has a…
A: Serine proteases are a family of enzymes that are capable of cleaving peptide linkage of proteins.…
Q: Assume that the translational error frequency, d, is 1 * 10–4. (a) Calculate the probability of…
A: The probability that a protein molecule is completely error free is (1-δ)n, where n is the number of…
Q: Because of the structural similarity between isoleucine and valine, the aminoacyl-tRNA synthetases…
A: Protein synthesis involves the formation of a polypeptide with the incorporation of all standard…
Q: Transfer RNA molecules are quite large, given that the anticodon consists of only three nucleotides.…
A: Proteins within the human body are made up of a small chain of building blocks, which are termed…
Q: Gene editing is also used to explore the structure and function ofproteins. For example, changes can…
A: From the observations, it gets clear that the amino acid aspartate shows the most functional…
Q: Which anticodon would you predict for a tRNA speciescarrying isoleucine? Is there more than one…
A: A codon can be defined as the three-nucleotide sequence present on the DNA or RNA which codes for…
Q: How many unique polypeptides would you expect to see synthesized by an in vitro translation reaction…
A: The correct answer is Option B - 1 According to the question, the mRNA code is poly (AC)n This…
Q: Imagine that you repeat the tRNA Selection experiment with modifications as follows: 1. Synthesize…
A: tRNA It is a leaf like structure can has anticodon sequence at one end and attached amino acid on…
Q: Posttranslational modifications serve several purposes. Discuss and give examples
A: When the proteins are synthesized then these proteins undergo posttranslational modifications.
Q: The following polynucleotide was synthesized and used as a template forpeptide synthesis in a…
A: The consecutive three nucleotides together form one codon. Each codon encodes for a particular amino…
Q: Regarding the production of therapeutic proteins, which one of the following statements is not…
A: Post-translational modification refers to the covalent and generally enzymatic modification of…
Q: An important validation of the genetic code occurred when George Streisinger determined the amino…
A: It is given that the specific single-base insertion mutation could be suppressed, with wild-type…
Q: The genetic code is thought to have evolved to maximize genetic stability by minimizing the effect…
A: Mutation is the alteration in the genome sequence. It can occur in the genetic code of eukaryotes,…
Q: The idea that primary sequence determines tertiary structure first came from experiments in the…
A: Proteins are the basic building blocks of life, and its biological functions are determined by their…
Q: HbS results from the substitution of valine forglutamic acid at the number 6 position in the b…
A: HbS is the result of a single base-pair mutation in the gene responsible for the beta-globin chain…
Q: Let's Apply In each of the following DNA sequences, write on your answer sheet the corresponding…
A: DNA ( Deoxyribonucleic acid ) is two stranded helical structure which act as genetic material in…
Q: Consider the hypothetical serine protease below, which shows the specificity pockets. The S, pocke…
A: As the name suggests that Serine protease is an enzyme that breaks protein-peptide bonds through…
Q: Assume that the translational error frequency, δ, is 1 x 10–4.(a) Calculate the probability of…
A: mRNAs are used to form protein by translation. The translation is performed using ribosomes, t-RNA…
Q: Sanger product of the sequencing of a template DNA is presented below. It is the polymorphic peptide…
A: Given : Ser-Gly-Lys-Glu-Gly-Lys-Lys 1 amino acid : 3 codons 7 amino acids : 7×3= 21 codons
Q: The ribosome can transfer any peptidyl group from the P-site tRNA to any aminoacyl group on the…
A: Proteins or polypeptides are sequence of amino acids which are linked by peptide bond or amide bond.…
Q: Knowing that the genetic code is almost universal, a scientist uses molecular biological methods to…
A: Genetic codon It is a group of three nucleotide that code for amino acids. They are total 64…
Q: Explain the interactions of specific tRNA with its synthetase, by including the importance of…
A: Answer) Cloverleaf structure of tRNA: It is formed due to the intramolecular hydrogen bonds and…
Q: A) Based on the mRNA sequence below, provide the corresponding DNA template (5'-3') and protein…
A: DNA is the genetic material in humans. It carries information that is transferred from one…
Q: Assume that the translational error frequency, 8, is 1 × 10-4. (a) Calculate the probability of…
A: The translation is the process of making a polypeptide chain from mRNA. The translation is catalyzed…
Q: Predict the amino acid sequence produced during translation by the following short hypothetical mRNA…
A: The alteration in the sequence of nucleotides of the genome of an organism is called a mutation.…
Q: For the case n = 5, the equilibrium constant for this reaction, Keg, is 5-10³ and for n= 6 Keg =…
A: Thermodynamics in biochemistry is the quantitative study of the change in energy which occurs in or…
Q: Knowing that the genetic code is almost universal, a scientist uses molecular biological methods to…
A: A genetic code translates the genetic information encoded within the deoxyribonucleic acid (DNA) or…
Q: Based on this alignment, you can identify areas of the protein sequences that are key regions of the…
A: Multiple sequence alignment is used to obtain optimal matching between three or more sequences of…
Q: EF-Tu binds all aminoacyl–tRNAs with approximately equal affinity so that it can deliver them to the…
A: Aminoacyl-tRNA is tRNA to which its cognate amino acid is chemically bonded. The aminoacyl-tRNA…
Q: The enzyme dihydrofolate oxidase has 3 adjacent asparagines residues (codon for asparagines is ACC):…
A: Site directed mutagenesis can be defined as the method to perform certain changes in the double…
Q: An important validation of the genetic code occurred when George Streisinger determined the amino…
A: The genetic code is the set of rules by which information encoded in genetic material is translated…
Q: The genetic code was solved partly by the use of in vitro systems to translate synthetic RNAs into…
A: According to the genetic code, a set of three nucleotides, that isis the triplet code for a…
Polypeptide is made up of chain of amino acids linked together. Polypeptides are connected together by the amide bonds or to be more specific by peptide bond.
There are two possibilities-
As it is not confirmed that from where did the codon begun, The codon might be AUA or UAU.
In the first case, if the codon is AUA, the amino acid formed will be Tyrosine.
In the second case, If the codon in UAU, the amino acid formed will be Isoleucine.
Step by step
Solved in 3 steps
- The following polynucleotide was synthesized and used as a template forpeptide synthesis in a cell-free system from E. coli. …AUAUAUAUAUAUAU…What polypeptide would you expect to be produced? What informationwould this give you about the code?The ribosome can transfer any peptidyl group from the P-site tRNA to any aminoacyl group on the A-site RNA, but the rate may vary with the identities of those groups. Propose an explanation why the ribosome synthesizes poly-Pro sequences extremely slowly compared to other peptide sequences.A segment of the wild type of DNA sequence coding for the site of N501 mutation is shown below. TGTTGGCTACTAATGGCTATCATCACACGC… identify the correct reading frame, the amino acid sequence in a single letter code, and the charged residues and approximate net charge for this portion of the protein at pH 8 Given the location and type of the mutation, why would scientists potentially be concerned about this variant?
- Gene editing is also used to explore the structure and function ofproteins. For example, changes can be made to the coding sequenceof a gene to determine how alterations in the amino acid sequenceaffect the function of a protein. Let’s suppose that you areinterested in the functional importance of a particular glutamicacid (an amino acid) within a protein you are studying. By geneediting, you make mutant proteins in which the glutamic acidcodon has been changed to other codons. You then test the encodedmutant proteins for functionality. The results are as follows: FunctionalityNormal protein 100%Mutant proteins containingTyrosine 5%Phenylalanine 3%Aspartic acid 94%Glycine 4%From these results, what would you conclude about the…Explain whether the specificity of lysine incorporation by lysyl-tRNA synthetase depends on tRNA or lysine, how does it work ?Using threonyl-tRNA synthetase as an example, account for the specificity of threonyl-tRNA formation.
- Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’- GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ By in vitro translating the mRNA, you determined that the translated peptide is 15 amino acids long. What is the expected peptide sequence in single letter abbreviations?Determine the codon sequence for the peptide sequence glycylserylcysteinylarginylalanine. How many possibilities are there?HbS results from the substitution of valine forglutamic acid at the number 6 position in the b chainof human hemoglobin. HbC is the result of a change atthe same position in the β chain, but in this case lysinereplaces glutamic acid. Return to the genetic code table and determine whether single-nucleotide changes can account for these mutations. Then view and examine the R groups in the amino acidsglutamic acid, valine, and lysine. Describe the chemicaldifferences between the three amino acids. Predict how thechanges might alter the structure of the molecule and leadto altered hemoglobin function.
- Posttranslational modifications serve several purposes. Discuss and give examplesFrom this overall anticodon sequence in tRNA, 3'-CAUCGGAAUAGAUCGCUAGUGGCAGGCAUAAUGAUCACCGGUCUGAGAAAAGUGGUACAUAUCAAC-5' Using ONE-letter amino acid code starting from N-terminus to C-terminus, what is the amino acid sequence that will be coded for?Please determine the order of aminoacids from a given genetic code? 5’-UGGUACGGUACUCCAC-3’