2. The following polynucleotide was synthesized and used as a template forpeptide synthesis in a cell-free system from E. coli.-· AUAUAUAUAUAUAU- ..What polypeptide would you expect to be produced? What informationwould this give you about the code?3. If the same polynudeotide described in Problem 2 is used with amitochondria-derived cell-free protein-synthesizing system, the product is... Met-Tyr-Met-Tyr-Met-Tyr- ..What does this say about differences between the mitochondrial and bacte-rial codes?

Since we answer only one question at a time, we are answering the first question listed here. Please…

Answered: 2. The following polynucleotide was…

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter30: Protein Synthesis

Section: Chapter Questions

Problem 2P

See similar textbooks

Similar questions

1- Biochemist Erwin Chargaff was the first to note that, in DNA, [A] = [T] and [G] = [C], equalities now called Chargaff’s rule. With the use of this rule, determine the percentages of all the bases in a DNA molecule which contains 35% thymine. Explain. 2- Similar equalities (i.e. [A]=[U] and [G]=[C]) are however not observed in RNA molecules. Explain the structural differences which dictate why Chargaff rule does not apply to RNA polynucleotides.
1. Although aminoacyl-tRNA synhtetases make few errors, occasionally an error. How can these error be detected and corrected? 2. Describe how the base pairing between the Shine-Delgarno sequence and the 30S subunit provides a mechanism for distinguishing a start codon form a methionine codon. What is the eukaryotic version of this mechanism?
1. Here is the amino acid sequence of part of a hypotheticalgene you want to clone:Pro-Arg-Tyr-Met-Cys-Trp-Ile-Leu-Met-Ser a. What sequence of five amino acids would give a 14-merprobe with the least degeneracy for probing a library tofind your gene of interest? Notice that you do not use thelast base in the fifth codon because of its degeneracy. b. How many different 14-mers would you have to makein order to be sure that your probe matches thecorresponding sequence in your cloned gene perfectly? c. If you started your probe one amino acid to the left of theone you chose in (a), how many different 14-mers would youhave to make? Use the genetic code to determine degeneracy.
1.Would you expect a solution of high salt to be able to denature ribonuclease? Why or why not? 2. You have read in the Human Perspective that (1) mutations in the PRNP gene can make a polypeptide more likely to fold into the PrPSc conformation, thus causing CJD and (2) exposure to the PrPSc prion can lead to an infection that also causes CJD. How can you explain the occurrence of rare sporadic cases of the disease in persons who have no genetic propensity for it? 3. Persons who are born with Down syndrome have an extra (third) copy of chromosome #21 in their cells. Chromosome #21 contains the gene that encodes the APP protein. Why do you suppose that individuals with Down syndrome typically develop Alzheimer’s disease at an early age?
1. Given the DNA sequence below: 5’-ACATGTGTACAGGCTTTGTCTGAATGGCTT-3’ 3’-TGTACACATGTCCGAAACAGACTTACCGAA-5’ Translate the mRNA. (Using the 3-letter code for amino acids, write the primary structure of the peptide that will be produced.) 2. Given the DNA sequence below: 5’-ACATGTGTACAGGCTTTGTCTGAATGGCTT-3’ 3’-TGTACACATGTCCGAAACAGACTTACCGAA-5’ Translate the mRNA. (Using the 3-letter code for amino acids, write the primary structure of the peptide that will be produced.)
The genetic code is thought to have evolved to maximize genetic stability by minimizing the effect on protein function of most substitution mutations (single-base changes). We will use the six arginine codons to test this idea. Consider all of the substitutions that could affect all of the six arginine codons.(a) How many total mutations are possible?(b) How many of these mutations are “silent,” in the sense that the mutantcodon is changed to another Arg codon?(c) How many of these mutations are conservative, in the sense that an Argcodon is changed to a functionally similar Lys codon?
Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’- GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ By in vitro translating the mRNA, you determined that the translated peptide is 15 amino acids long. What is the expected peptide sequence in single letter abbreviations?
1. Here is the amino acid sequence of part of a hypotheticalgene you want to clone:Pro-Arg-Tyr-Met-Cys-Trp-Ile-Leu-Met-Sera. What sequence of fi ve amino acids would give a 14-merprobe with the least degeneracy for probing a library tofi nd your gene of interest? Notice that you do not use thelast base in the fi fth codon because of its degeneracy.b. How many different 14-mers would you have to makein order to be sure that your probe matches thecorresponding sequence in your cloned gene perfectly?c. If you started your probe one amino acid to the left of theone you chose in (a), how many different 14-mers would youhave to make? Use the genetic code to determine degeneracy.
The genetic code was solved partly by the use of in vitro systems to translate synthetic RNAs into peptides. In these systems, ribosomes, amino acids, and buffers that support translation are added and there is no control of where translation begins. AAA = Lys; AUA = Ile; AAU = Asn; UAA = stop. What peptides would NOT be produced in an in vitro system if the following oligonucleotide were added: AAAAAAAAAUAAAAAAAA Select one: a) Lys-Lys-Lys-Lys-Lys-Lys-Lys-Lys b) Lys-Lys-Ile-Lys-Lys c) Lys-Lys-Asn-Lys-Lys
Knowing that the genetic code is almost universal, a scientist uses molecular biological methods to insert the human β-globin gene (Shown in Figure 17.11) into bacterial cells, hoping the cells will express it and synthesize functional β-globin protein. Instead, the protein produced is nonfunctional and is found to contain many fewer amino acids than does β-globin made by a eukaryotic cell. Explain why.
In 1962, F. Chapeville and others reported an experiment in which they isolated radioactive 14C-cysteinyl-tRNACys (charged tRNACys + cysteine). They then removed the sulfur group from the cysteine, creating alanyl-tRNACys (charged tRNACys + alanine). When alanyl-tRNACys was added to a synthetic mRNA calling for cysteine, but not alanine, a polypeptide chain was synthesized containing alanine. What can you conclude from this experiment?
1. Given the following three mRNA sequences, which 2 sequences code for the same protein?#1 AGU UUA GCA ACG AGA UCA#2 UCG CUA GCG ACC AGU UCA#3 AGC CUC GCC ACU CGU AGU 2. Look at the following sequence: THE FAT CAT ATE THE RAT. Delete the first H and regroup the letters in groups of three- write out the new groups of three. Does the sentence still make sense? What type of mutation is this an example of?

SEE MORE QUESTIONS

Recommended textbooks for you

Biochemistry

ISBN:

9781305577206

Author:

Reginald H. Garrett, Charles M. Grisham

Publisher:

Cengage Learning

Biochemistry

ISBN:

9781305577206

Author:

Reginald H. Garrett, Charles M. Grisham

Publisher:

Cengage Learning

SEE MORE TEXTBOOKS