what are we looking at in part (b)? Is this an11-nm fiber, a 30-nm fiber, or a 300-nm fiber? Does this DNAcome from a cell during M phase or interphase? 0.5 um(a) H1 histone not bound-beads on a string0.5 um(b) H1 histone bound to linker region-nucleosomes morFIGURE 10.12 The nucleosome structure of e

DNA is the main constituent of the chromosome. It contains all information about protein that forms…

Answered: 0.5 um (a) H1 histone not bound-beads…

0.5 um (a) H1 histone not bound-beads on a string 0.5 um (b) H1 histone bound to linker region-nucleosomes mor FIGURE 10.12 The nucleosome structure of e

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter29: Transcription And The Regulation Of Gene Expression

Section: Chapter Questions

Problem 9P

See similar textbooks

Related questions

Q: True or False 1. Histone proteins are able to associate with DNA segments because of the anionic…

A: Nucleic acid: It was first discovered by " Friedrich Miescher", from the pus cells nuclei . Nucleic…

Q: 5' UGUCAUGCUCGUCUUGAAUCUUGU GAUCCUCGUUGGAUUAAUUGU— 3' Translate the sequence of bases in the…

A: The amino acid chains are produced from the mRNA by the process of translation. In this translation…

Q: Describe the structure of nucleosome ( please keep it short as much as you can ).

A: A nucleosome is a basic structural unit of eukaryotic chromatin . It consists of approximately 150…

Q: AAUCCCAAU ITTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG-W' JAATCCCAATCCCAATCCCAA-X' Figure 3 (i) Label the…

A: Telomeres are the structures(caps) that are present at the end of the chromosomes, their fhbction is…

Q: What is the diameter of a nucleosome?

A: A nucleosome is the basic formational unit of the DNA packaging in eukaryotic cells. The structure…

Q: Why are some transposons medically important?

A: Certain sequences are repetitive such as satellite DNA, transposable elements, etc. They are studied…

Q: You have been sent the first samples of a newly discovered Martian microorganism for analysis of its…

A: Packaging of Eukaryotic DNA is highly ordered. Initially the DNA(negatively charged) is conjugated…

Q: Describe what structural changes convert a chromosomal region that is 300 nm in diameter to one that…

A: Chromosomes are thread-like structures that are located in the nucleus. It is composed of protein…

Q: Consult Figure 2. Would you consider this figure to be depicting euchromatin, or heterochromatin,…

A: Chromatin exists as euchromatin or heterochromatin. Euchromatin are loosely bound,less condensed,…

Q: Which amino acid repeat pattern would most likely form a stable a-helix with one hydrophobic side?…

A: Amino Acids are biochemical molecules that combine to make proteins; as a result, they are referred…

Q: 5' 3' For numbers 6 to 10, refer to the image above and answer the questions. 9. How are Okazaki…

A: Okazaki fragments : These are pieces of DNA which are the transient components of the lagging strand…

Q: Z-DNA derives its name from the zig-zag conformation of phosphate groups. What features of the DNA…

A: There is various possible double helical structure of the DNA; Z-DNA is one of them. In Z-DNA, helix…

Q: Huntington's disease in regards to Trinucleotide repeats give detailed reponses provide exmaples

A: Huntington's disease(HD) is caused due to mutation in the HD gene where the trinucleotide…

Q: How many different polypeptides would you expect to see synthesized by an in vitro translation…

A: The mRNA is a sequence of ribonucleotides that contains three possible reading frames. Only one…

Q: Human adult hemoglobin is a tetramer containing two alpha (a) and two beta (b) polypeptide chains.…

A: Insights into the development of hemoglobins and their qualities are a plentiful wellspring of…

Q: Check the new protein created by your new DNA. Describe how this changed the protein (amino acid…

A: Any change in the DNA is called mutation. Some Mutations are beneficial because they add on the…

Q: 34. Chromatin is composed of roughly equal amounts of DNA and proteins called histones. Nucleosome…

Q: 2.1 Given the following eukaryotic DNA strand, transcribe and translate the DNA into a polypeptide…

A: Great Biologist, Francis Crick proposed the Central Dogma in the molecular biology, which states the…

Q: Z-DNA derives its name from the zig-zag conformation ofphosphate groups. What features of the DNA…

A: Z-DNA is one of the many possible double helical structures of DNA. It is a left handed double…

Q: In chromosomes, doubly-stranded DNA wraps tightly around histone proteins. Think about the structure…

A: DNA It is a biomolecule that carries genetic information and information for the process of protein…

Q: Let’s suppose you have isolated chromatin from some bizarreeukaryote with a linker region that is…

A: Introduction Each human cell contains around 3 metres of DNA which contains about 3 Billion base…

Q: N' C' = Polypeptide X d a b = SRP 5'- = translocator e Which region(s) of polypeptide X would bind…

A: Ribosomes refer to the site where the protein synthesis takes place. It comprises rRNA and protein.…

Q: 7. The following amino acid sequence represents part of a protein. The normal sequence and a mutant…

A: A mutation is a change in the nucleotide sequence of an organism's genome, virus, or…

Q: 3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5' Q: Based on written…

A: The DNA has two strands one is the Template strand and other is the coding strand. Based on the…

Q: 2ith the diagram provided please write the polypeptide. sequence obtained from the translation of…

A: INTRODUCTION Translation is the process of translating the sequence of a messenger RNA (mRNA)…

Q: . Geneticists interested in human hemoglobins havefound a very large number of mutant forms. Some…

A: A normal molecule of haemoglobin consists of four globin chains (two alpha and two beta chains).…

Q: A diploid human cell contains approximately 6.4 billion base pairs of DNA. Q.How many histone…

A: The histones are the basic proteins family that are attached to DNA inside the cell. These basic…

Q: 1. Heterochromatin is typically gene-rich and composed of loosely-packed DNA that is…

A: “Since you have asked multiple question, we will solve the first question for you. If you want any…

Q: A) Based on the mRNA sequence below, provide the corresponding DNA template (5'-3') and protein…

A: DNA is the genetic material in humans. It carries information that is transferred from one…

Q: Under physiological conditions, DNA ordinarily formsB-DNA. However, RNA hairpins and DNA-RNAhybrids…

A: DNA and RNA are the biomolecules that are responsible for carrying genetic information in all living…

Q: 5’-GATCAGCTGACTGGATCCGTCCTCAACGTCAGGATCCAGCTTCAAG-3’ 1. How many cuts do you expect this enzyme to…

A: Some enzymes are called endonucleases cleave the phosphodiester bonds that exist in the DNA. Some…

Q: Basisse triplet nommer/ Base triplet number 1 2 3 4 5 6 7 Menslike DNA-volgorde /…

A: The order of nucleotides in the nucleic acid is referred to as nucleic acid sequence. The process of…

Q: A diploid human cell contains approximately 6.4 billion base pairs of DNA. Q. How many nucleosomes…

A: Number of base pairs in human diploid cell= 6.4 x 109 base pairs Given that linker DNA contains 40…

Q: 6. If you are given the DNA sequence: T-A-C-C-G-A-A-T determine the complementary RNA strand.

A: Introduction :- The term "DNA sequencing" refers to a common laboratory procedure for determining…

Q: Nucleosome structure: Identify the proteins indicated by the arrow. Hint: there are two of these…

A: option -a)histone H2A-H2B diner is correct.

Q: Assuming that the 30-nm chromatin fiber con-tains about 20 nucleosomes (200 bp/nucleosome) per 50nm…

A: Chromatin fibres are made up of nucleosomes, which are small discrete particles that form a…

Q: To hold bacterial DNA in a more compact configuration, specificproteins must bind to the DNA and…

A: The DNA ( deoxyribonucleic acid) is the genetic material of the organism. In Eukaryotic organisms…

Q: Describe the distinguishing features of the solenoid and zigzag models

A: The solenoid and zig-zag model both describe the pattern in which DNA is packed with the help of…

Q: 5' ACTGAGGATTCGGACAGCAATAGGATG 3' The -2 reading frame of the sequence above gives the following…

A: Answer. A genetic code is a triplet code called a codon. A given amino acid can be specified by more…

Q: Protein A has a pl of 6.5 and appears to form tetramers. Protein B has a pl of about 8.5, and…

A: Histone proteins are strongly basic protein due to abundant lys and arg residues. It is found in the…

Q: Cordycepin (structure shown), a broad-spectrum antibiotic was used to treat a bacterial infection.…

A: Antibiotics are potent medications that fight infections and, when taken correctly, can save lives.…

Q: Assuming that 145 base pairs of DNA wrap around the histone octamer 1.75 times, estimate the radius…

A: A histone octamer is the eight protein complex located at the core of the nucleosome and histone…

Q: Human Chromosome 22 (48 × 106 nucleotide pairs in length) has about 700 protein-coding genes, which…

A: Introduction :- Chromosomes are thread-like structures within the nucleus that securely wrap DNA.…

Q: The octamer core of nucleosomes contains: а. 4H2A, 4HB, 2нз, 2H4 b. 2H2A, 2HB, 2нЗ, 2H4

A: Nucleosome is the basic structural unit of DNA packaging in eukaryotes. The structure of the…

Concept explainers

Dissection

Dissection is the process of cutting up the tissue of a dead or live animal or plant, to do anatomical studies and surgical treatments. The purpose of dissection is to learn more about the overall structure of organs and organ systems and thereby understand the physiology of the organism.

Question

what are we looking at in part (b)? Is this an
11-nm fiber, a 30-nm fiber, or a 300-nm fiber? Does this DNA
come from a cell during M phase or interphase?

0.5 um
(a) H1 histone not bound-beads on a string
0.5 um
(b) H1 histone bound to linker region-nucleosomes mor
FIGURE 10.12 The nucleosome structure of e

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step 3

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

A diploid human cell contains approximately 6.4 billion base pairs of DNA. a. How many nucleosomes are present in such a cell? (Assume that the linker DNA encompasses 40 bp.) b. How many histone proteins are complexed with this DNA?
A diploid human cell contains approximately 6.4 billion base pairs of DNA. Q.How many histone proteins are complexed with this DNA?
True or False 1. Histone proteins are able to associate with DNA segments because of the anionic nature of the amino acids arg and lys. 2. DNA molecules can perform their function in replication and transcription as long as the hydrogen bonds between the bases remain intact. 3. A double helix makes one complete turn every 10 residues (3.4nm). Therefore the distance between base pairs is 0.34nm.
A particular protein has the amino acid sequenceN . . . Ala-Pro-His-Trp-Arg-Lys-Gly-Val-Thr . . . Cwithin its primary structure. A geneticist studyingmutations affecting this protein discovered that several of the mutants produced shortened protein molecules that terminated within this region. In one ofthem, the His became the terminal amino acid.a. What DNA single-base change(s) would cause theprotein to terminate at the His residue?b. What other potential sites do you see in the DNAsequence encoding this protein where mutation ofa single base pair would cause premature termination of translation?
A diploid human cell contains approximately 6.4 billion base pairs of DNA. Assuming that the linker DNA encompasses 35 bp, how many nucleosomes are present in such a cell? Use two significant figures. How many histone proteins are complexed with this DNA? use two significant figures.
Here is a DNA coding strand’s sequence and direction: 5’-ATGCCGATATAG-3’ . What would be the amino acid sequence in the polypeptide encoded by this DNA?
Helicase Unwinding of the E. coli Chromosome Hexameric helicases, such as DnaB, the MCM proteins, and papilloma virus El helicase (illustrated in Figures 16.22 to 16.25), unwind DNA by passing one strand of the DNA duplex through the central pore, using a mechanism based on ATP-dependent binding interactions with the bases of that strand. The genome of E. coli K12 consists of 4,686,137 nucleotides. Assuming that DnaB functions like papilloma virus El helicase, from the information given in Chapter 16 on ATP-coupled DNA unwinding, calculate how many molecules of ATP would be needed to completely unwind the E. coli K 12 chromosome.
Under physiological conditions, DNA ordinarily formsB-DNA. However, RNA hairpins and DNA-RNAhybrids adopt the structure of A-DNA. Considering thestructural differences between DNA and RNA, explain thisphenomenon.
1. In the human gene for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood cells), the first 30 nucleotides in the amino-acid-coding region is represented by the sequence:3'-TACCACGTGGACTGAGGACTCCTCTTCAGA-5'. What is the sequence of the partner strand?
4–44 You have been sent the first samples of a newly discovered Martian microorganism for analysis of its chromatin. The cells resemble Earthly eukaryotes and are composed of similar molecules, including DNA, which is located within a nucleus-like structure in the cell. One member of your team has identified two basic histone-like proteins associated with the DNA in roughly an equal mass ratio with the DNA. You isolate nuclei from the cells and treat them with micrococcal nuclease for various times. You then extract the DNA and run it on an agarose gel alongside DNA from rat-liver nuclei that had been briefly digested with micrococcal nuclease. As shown in Figure 4–9, the digest of rat-liver nuclei gives a standard ladder of nucleosomes, but the digest of the Martian organism gives a smear of products with a nuclease-resistant limit of about 300 nucleotides. As a control, you isolate the Martian DNA free of all protein and digest it with micrococcal nuclease: it is completely…
The sequence of the complementary strand of 5' GTCTATAGAC 3' is_____________ Is there anything special about this sequence?
What is the length in AA’s of the LilP protein? Assume fMet is NOT CLEAVED. Enter just the number, nothing else! Write out the sequence of the polypeptide in AA: use the three letter notation, e.g. Met-Ser-Pro- A lilP mutant called lilPXS is isolated that produces a truncated polypeptide of only 6 AA in length. Describe a single basepair DNA change that would lead to this truncated version of the protein. Multiple options are possible (100 words max.)