Insertion sequence -Mobile element Transposase gene O FIGURE 8.27 Transposable Elements The borders of Inverted repeat Inverted repeat insertion sequences are defined by inverted repeats 15-20 nucleotides in length. The first six nucleotides are shown here in 5' 3' ТCGA тG AG CTAC. 5' 5' 3' expanded view to demonstrate their inverted orientation. САТСG GTAGC Composite transposons consist of two IS elements and the DNA between them, all of which move as a single unit. 3'LL 3' 5' Composite transposon -Mobile element- -Insertion sequence- Antibiotic-resistance gene- -Insertion sequence-

Insertion sequence -Mobile element Transposase gene O FIGURE 8.27 Transposable Elements The borders of Inverted repeat Inverted repeat insertion sequences are defined by inverted repeats 15-20 nucleotides in length. The first six nucleotides are shown here in 5' 3' ТCGA тG AG CTAC. 5' 5' 3' expanded view to demonstrate their inverted orientation. САТСG GTAGC Composite transposons consist of two IS elements and the DNA between them, all of which move as a single unit. 3'LL 3' 5' Composite transposon -Mobile element- -Insertion sequence- Antibiotic-resistance gene- -Insertion sequence-

Name: Why are some transposons medically important? Insertion sequence-Mobil
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Why are some transposons medically important? Insertion sequence-Mobile elementTransposase geneO FIGURE 8.27 Transposable Elements The borders ofInverted repeatInverted repeatinsertion sequences are defined by inverted repeats 15-20nucleotides in len

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter30: Protein Synthesis

Section: Chapter Questions

Problem 12P

See similar textbooks

Similar questions

Codon-Anticodon Recognition: Base-Pairing Possibilities (Integrates with Chapter 11.) Draw base-pair structures for (a) a G:C base pair. (b) a C:G base pair. (C) a G:U base pair, and (d) a U:G base pair. Note how these various base pairs differ in the potential hydrogen-bonding patterns they present within the major groove and minor groove of a double-helical nucleic acid.
COMPLEMENTARY DNA SEQUENCE OF GACGGCTTAAGATGC
Huntington's disease in regards to Trinucleotide repeats give detailed reponses provide exmaples
Typed explanation only Codons in mRNA molecule and their corresponding amino acids UUU Phenylalanine UAU tyrosine UUA leucine UAA nonsense GCA alanine AAU asparagine AAG lysine UGC cysteine GUU valine UCG, UCU serine Refer to Table 8.2. If the sequence of amino acids encoded by a strand of DNA is serine-alanine-lysine-leucine, what is the order of bases in the sense strand of DNA? Group of answer choices 5' TGTGCTTTCTTA 3' 3' AGACGTTTCAAT 5' 3' UGUGCAAAGUUA 5' 5' AGAGCTTTGAAT 3' 3' TCTCGTTTGTTA 5'
⦁ Original: ATTTGAGCCMutated: ATTGAGCC. This is an example of what kind of mutation?
ATTTGAGCC- OriginalATTGAGCC - Mutated The example above is an example of a Nonsense Deletion- Substitution Insertion- Frameshift Deletion -Frameshift
Problem B. DNA: Codon SegmentingThe way that DNA is often interpreted as genes is in groups of three nucleotides at a time, called “codons.” Thus, the DNA strand dna_str = 'agctttcattctgac' Can be broken into codons in the following three ways: agc ttt cat tct gac a gct ttc att ctg ac ag ctt tca ttc tga c # reading frame 0 # reading frame 1 # reading frame 2 Notice that in these lines, we start reading codons at string indexes 0, 1 and 2. The three different start indices are known as reading frames, and are called reading frame 0, reading frame 1 and reading frame 2, respectively. It is not always clear which of these frames will be read by genetic transcription mechanisms, so it is often useful to be able to be flexible and consider any of them when working with DNA strands. Write a function segment that takes as an input a string containing a DNA strand, and a reading frame (0, 1 or 2) to use. The function should return a list containing the sequence of individual codons. You…
mRNA sequence of A gene Write the amino acid sequence of the gene A. 5’ AAACUGUGACUGAACCUCAAACCCCAAACCAGCCCGAGGAGAACCACAUUCUCCCAGGGA CCCAGGGCGGGCCGUGACCCCUGCGGCGGAGAAGCCUUGGAUAUUUCCACUUCAGAAGCCUACUGGGGAAGGCUGAGGGGUCCCAGCUCCCCACGCUGGCUGCUGUGCAGAUGCUGGACGACAGAGCCAGGAGGGAGGCCGCCAAGAAGGAGAAGGUAGAGCAGAUCCUGGCAGAGUUCCAGCUGCAGGAGGAGGACCUGAAGAAGGUGAUGAGACGGAUGCAGAAGGAGAUGGACCGCGGCCUGAGGUAGAAGCCGCUGGGGCUUGGGGCU-3’
5’-AUGCCGGACUGAAAU-3’ What is the sequence of the resulting protein assuming the ribosome takes the first AUG as triplet codon ?
Instructions -Answer thr Questions properly. MUTATION: Fill in the correct nucleotide base pairing and amino acid sequence of the mutated DNA "MUTATED DNA" (SEE IMAGE) a. What is the 3’-5’ DNA sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX) b. What is the mRNA sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX) c. What is the tRNA sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX) d. What is the amino acid sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX) e. What is the most convincing type of mutation had occurred? - Substitution - Missense (Frameshift resulting Missense; Frameshift resulting Nonsense; Substitution – Silent; Substitution – Missense; Substitution – Nonsense)
Number of Okazaki Fragments in E. coli and Human DNA Replication Approximately how many Okazaki fragments are synthesized in the course of replicating an E. coli chromosome? How many in replicating an â€œaverageâ€� human chromosome?
A fragment of bacterial DNA reads: 3’ -TACCTATAATCTCAATTGATAGAAGCACTCTAC- 5’ Assuming that this fragment is the template strand, what is the sequence of mRNA that would he transcribed? (Hint: Be sure to identify the initiation site.)