Answered: 90. If the mRNA sequence is 5' -…

Name: 90. If the mRNA sequence is 5' - START(AUG) - UUU - AAA - AGU - GGU -
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: 90. If the mRNA sequence is 5' - START(AUG) - UUU - AAA - AGU - GGU - 3' , then what is the corresponding tRNA anticodon sequence? A.5' - UAC - AAA - UUU - UCA - CCA- 3'B.3' -

Science

Biology

90. If the mRNA sequence is 5' - START(AUG) - UUU - AAA - AGU - GGU - 3' , then what is the corresponding tRNA anticodon sequence? A.5' - UAC - AAA - UUU - UCA

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter15: From Dna To Protein

Section: Chapter Questions

Problem 10TYK: A part of an mRNA molecule with the sequence 5-UGC GCA-3 is being translated by a ribosome. The...

See similar textbooks

Similar questions

A part of an mRNA molecule with the sequence 5-UGC GCA-3 is being translated by a ribosome. The following activated tRNA molecules are available. tRNA Anticodon Amino Acid 3-GGC-5 Proline 3-CGU-5 Alanine 3-UGC-5 Treonine 3-CCG-5 Glycine 3-ACG-5 Cysteine 3-CGC-5 Alanine Which two of them can bind correctly to the mRNA so that a dipeptide can form? a. cysteinealanine b. prolinecysteine c. glycinecysteine d. alaninealanine e. threonineglycine
_______ are removed from new mRNAs. a. Introns c. Poly-A tails b. Exons d. Amino acids
1. Considering the following nucleotide sequence in an mRNA molecule: 5’ AUG UUA CGU AAU GCU GUC GAA UCU AUU UGC UUU ACA UAA 3' a) Write the sequence of the DNA template (antisense) strand from which the mRNA was synthesized. b) Write the sequence of the DNA coding (sense or informational) strand complementary to the template strand. c) Write the sequence of tRNA anticodon that corresponds to the given mRNA molecule. d) Write the amino acid sequence of the peptide synthesized from the given mRNA nucleotide sequence. e) Draw the structure of the pertide fragment made up of the first five (5) amino acids in the given polypeptide.
1. Using the genetic code, determine the sequence of amino acids encoded by the mRNA codocn sequence 5' GCC-AUG-GUA-AAA-UGC-GAC-CCC 3' 2. Using the genetic code, determine the sequence of amino acids encoded by the mRNA codocn sequence 5' CAU-CCU-CAC-ACU-GUU-UGU-UGG 3'
1. Which is the correct of mRNA strand if you have a tRNA of GCA-AUG-UCC-CGU? A. 5’-CGU-UAC-AGG-CCA-3’ B. 3’-CGU-UAC-AGG-CCA-5’ C. 5’-CGT-TAC-TGG-GCA-3’ D. 3’-CGT-TAC-TGG-GCA-5’ 2. Which is the correct amino acids using the mRNA strand of 5’-AUG-CAU-CAA-3’? A. MET-HIS-GLN B. GLN-HIS-MET C. MET-GLN-HIS D. HIS-MET-GLN
A single template strand of a DNA molecule is represented by 3’atgtaccatgcgcaaatttaaaggccc5’. a) Using the same strand above as a template, write the pre-mRNA transcript. b) List the molecules that must be present for DNA to be transcribed. Briefly describe their function. c) What are three modifications that happen to pre-mRNA before it becomes mature mRNA
7. A segment of a DNA strand consists of ...GCTTAGACCTGA.... (a) Identify the expected nucleotide order in the complementary mRNA (b) Identify the sequence of amino acids coded for by this segment of DNA. (c) Describe the bond that forms during translation to link amino acids together. Identify the functional groups that react and the atoms involved.
1. A tRNA to which the correct amino acid has been attached is called?
Given is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the red blood cells): 5’ TAC-CAC-GTG-GAC-TGA-GGA-CTC-CTC-TTC-AGA 3’ a. What is the complementary strand? b.Deduce the mRNA in this coding region. c.What is the amino acid sequence based on this mRNA? d. A very important mutation in human hemoglobin occurs in this DNA sequence, where the T at nucleotide 20 is replace with an A. The mutant hemoglobin is called sickle cell hemoglobin and is associated with severe anemia. What is the amino acid replacement that results in sickle-cell hemoglobin?
Given is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the red blood cells): 5’ TAC-CAC-GTG-GAC-TGA-GGA-CTC-CTC-TTC-AGA 3’a. What is the complementary strand?b. Deduce the mRNA in this coding region.c. What is the amino acid sequence based on this mRNA?d. A very important mutation in human hemoglobin occurs in this DNA sequence, where the T at nucleotide 20 is replace with an A. The mutant hemoglobin is called sickle cell hemoglobin and is associated with severe anemia. What is the amino acid replacement that results in sickle-cell hemoglobin?
3’ G G A U A C G U C A C C G G U A U A A G G U U U C G U A U C G 5’ If the RNA synthesized above is a functional mRNA and all the nucleotides belong to an exon, a. how many codons are present in this mRNA? b. how many codons actually code for a protein in this mRNA? c. what stop codon is present in this mRNA?
1. Classify the type of mutation that have taken place: silent, missense and nonsense as a result of a single base substitution from UCG codon which codes for cysteine:a) AGC (ser): ________b) UGU (cys): ________c) GGC (gly): _______d) UGA (stop): _______e) UUC (phen): _______2. A single base addition and a single base deletion approximately 15 bases apart in the mRNA specifying the protein lysozyme from the bacterial virus T4 caused a change in the protein fromits wil-type composition….lys-ser-pro-ser-leu-asn-ala-ala-lys…..to the mutant form lys-val-his-his-leu-met-ala-alalys.a. Decipher the segment of mRNA for both the original protein and the double mutant.b. Which base was added? Which was deleted?3. Given is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the red blood cells): 5’ TAC-CAC-GTG-GAC-TGA-GGA-CTC-CTC-TTC-AGA 3’a. What is the complementary strand?b. Deduce the mRNA in this coding region.c. What is the amino acid sequence based on this…