1. Which of the following catalyzes formation of peptide bonds between amino acids during translation in Eukaryotes? 16S FRNA 18S FRNA 23S FRNA 28S FRNA 2. Most proteins interact with DNA through major groove except RNA Polymerase II Peptidyl Transferase Transcription Factor II D RNA polymerase II 3. The expression of housekeeping genes in cells needs to be induced by an external stimulus options:
Q: Which of the following statements are true about eukaryotic mRNA?a. The sigma factor is essential…
A: Proteins within the human body are made up of a small chain of building blocks, which are termed as…
Q: 1. For each of the following, explain how eukaryotic transcriptional initiation would be affected.…
A: According to bartleby expert guidelines, when multiple questions are posted we are allowed to answer…
Q: 1) RNA polymerase 2) sigma (o) subunit of RNA polymerase 3) rho (p) factor 4) transcription factors…
A: RNA polymerase extend or polymerise RNA. Sigma subunit of RNA polymerase binds to promoter…
Q: Which of the following regions of the DNA is NOT transcribed by RNA polymerase? 1. -10/-35 promoter…
A: RNA polymerase is an enzyme that helps in the synthesis of RNA from the DNA template. This enzyme…
Q: The RNA-induced silencing complex (RISC) _____ i. Binds to and unwinds ds siRNA/miRNA to produce…
A: The answet is b. II only RNA-induced silencing complex(RISC) is a multiprotein complex which…
Q: A certain template DNA strand has the following nucleotide sequence:…
A: DNA is doubled stranded and has two strands - a template and a coding strand. Here, given a template…
Q: 2. The following schematic shows the chromosomal location of Gene 1 and Gene 2. The corresponding…
A: g)It will not be same. The direction of transcription is always determined by the location of the…
Q: 1- which of the following can be used for treating/combating bacterial infections a. targeting…
A: Bacteria are unicellular organisms, having sizes of 0.5 micrometers to 2 micrometers. They cause…
Q: Which of the following statements are false about prokaryotic transcription? In bacteria,…
A: Transcription is the production of RNA from the DNA template strand. It is also known as gene…
Q: What is the central dogma? What are the compounds involved in this process? (Keywords: transcription…
A: A "nucleic acid" is a linear polymer of nucleotides that is a component of the cell's information…
Q: 1. Explain the functioning and regulation of the following operons: lac, trp. 2. Explain the…
A: Every organism have various charcyerstics why may or may not be similiar to each individual. Tgese…
Q: Which of the following mechanisms do prokaryotes use to produce different prdtein products from a…
A: In prokaryotes, the genes encoding proteins of related functions are transcribed under the control…
Q: 1. Contents of the diagram below was discovered in the 1960s. Explain in detail what this diagram is…
A: Transcription is defined as the process by which the information present in a strand of DNA will be…
Q: 1. Lac and Trp Operon are two different processes of sugar and amino acid. Describe the differences…
A: Lac and Trp operon are found in E. coli and other bacteria.
Q: 83) The RDRP of the rotavirus a. Only produced in the first round of translation b. It is…
A: RdRP- is RNA dependent RNA polymerase. All retroviruses have RNA dependent RNA polymerases.
Q: which signal serves a similar function as the Shine-Dalgarno Sequence in prokaryotes? A. The…
A: The Shine–Dalgarno sequence is a ribosomal binding site in prokaryotic mRNA, generally located…
Q: 1. Transcription: Write out the sequence of mRNA that would result from transcription of the…
A: The flow of genetic information from DNA to RNA, RNA to protein synthesis is called central dogma.…
Q: A prokaryotic gene was transcribed then trans antibiotics X was added, and the products of t steps…
A: Antibiotic are the key substances which act on the major pathways of replication, transcription or…
Q: Multiple 3′ cleavage sites result in a. multiple genes of different lengths. b. multiple pre-mRNAs…
A: Multiple 3' cleavage sites produce different length of RNA transcript as they contain potential…
Q: 3. The promoter region contains a consensus sequence where transcription factors bind to initiate…
A: 1) For the initiation of transcription, the RNA polymerase enzyme needs to enter in between the DNA…
Q: scientist, Dr. Doom would like to create a novel antibiotic by targeting translation in bacterial…
A: Transcription is a process in which formation of transcript of RNA from DNA by the process of…
Q: 1. The SARS-CoV-2 virus (causing Covid-19) has an RNA genome, which is replicated using an…
A: Viruses contain nucleic acid/ribonucleic acid in the core region while the exterior/ envelope…
Q: 2. There is no sigma factor on the RNA polymerase II. How does RNA polymerase Il know where to start…
A: Usually in Eukaryotic transcription initiation the transcription factor identifies promoter and then…
Q: Fill the blanks. 1. Mutations in a GC box in the 5' upstream region from the protein coding…
A: 1. Mutations in a GC box in the 5' upstream region from the protein coding sequence of a gene would…
Q: Shown below is a nucleotide sequence alignment consisting of corresponding sequences of the same…
A: A change in the normal specific DNA sequence that can arise due to the anomaly is DNA replication or…
Q: 1. A strain of E. coli is genetically engineered in which the lacZ and lacY removed and replaced…
A: Operon acts as a single regulated unit having one or more structural gene, promoter gene, a…
Q: Differentiate transcription in both prokaryotic and eukaryotic cells. 2.Discuss the encoding of…
A: Prokaryotes have simple cellular organisation with no nucleus and membrane bound organelles where as…
Q: ) Below are some events that occur in the process of translating mRNA into a protein in a bacterial…
A: The translation is the process of creating protein from RNA. Hereditary information is encoded in…
Q: Which of the following regions of the DNA is transcribed by RNA polymerase AND is “understood” by…
A: Transcription Transcription is the process where DNA is transcribed into RNA with the help of…
Q: Which of the following conditions will result to deactivation of a gene? a. histone methylation b.…
A: In this question we have to describe about regulation of genes . See full answer in step 2.
Q: Which of the following is a true statement concerning condons
A: Codons are nucleotide triplets that are read together in order to specify amino acids during…
Q: Antibiotics that selectively inhibit bacterial growth exploit differences between bacterial and…
A: Antibiotic action that selectively functions on inhibition of cellular activities of the bacterial…
Q: A scientist mutates eIF-2 to eliminate its GTP hydrolysis capability. How would this mutated form of…
A: Selection of the AUG start codon for translation in eukaryotes is governed by codon-anticodon…
Q: 5. DNA is made of two strands that are antiparallel. If one strand runs from 3' to 5' direction the…
A: Transcription is the synthesis of RNA and translation is the synthesis of proteins. There is a…
Q: . Which of the following repair mechanisms can lead to frameshift mutations? a. Nonhomologous…
A: 1.Answer-- correct option is (b) Nucleotide excision repair
Q: A gene with the following DNA sequence is transcribed and translated: 5’ TAGCTACGGAAAGCGTACACGGACT…
A: Transcription is the process of the formation of RNA from the DNA template strand.
Q: 4 ______________ studies revealed that some mRNA molecules are formed by splicing pre-mRNA.…
A: 4 ______________ studies revealed that some mRNA molecules are formed by splicing pre-mRNA.…
Q: Which among A - D is false regarding antisense RNAs? A) O they occur in protein coding genes B) O…
A: It is a tool for preventing gene expression, they are formed by synthetic antisense…
Q: What is the sequence of the mRNA transcript that will be produced from the following sequence of…
A: Transcription is the process of synthesis of RNA from DNA. RNA polymerase catalyzes this process by…
Q: A. Taq polymerase B. Release factors C. Reverse transcriptase D. CDNA 1. Catalyzes peptide bond…
A: 1. H peptidyl transferase 2. G aminoacyl tRNA synthetase 3. K shine dalgarno sequence 4. I…
Q: RNA polymerases generally require a primer to begin transcription. (T) (F) The Death Cap…
A: As per the multiple questions policy, I am attempting the very first question posted by you. Kindly,…
Q: Transcription of protein-coding genes in the eukaryotic nucleus a. produces mature mRNAs. b. is…
A: TRANSCRIPTION:- During the process of gene expression, DNA is first copied into an mRNA molecule…
Q: 1. Which of the following enzymes can polymerize deoxyribonucleotides into DNA? A) Primase B) DNA…
A: There are different biomolecules present, and they include nucleic acids, proteins, lipids,…
Q: 5’ UGG CAA UCC UAC GAU 3’ Write out the sequence of the anticodon in the tRNA that would bind to…
A: Note: As per the guidelines only one question has to be answered. Please ask the other question…
Q: 3.1 Which of the following is NOT true about the lac operon? I) The lac operon is use to help…
A: ANSWER;- B) is NOT true about the lac operon. Allolactose binds to the repressor so they can bind…
Q: double-stranded RNA
A: ribonuclease III family Enzymes from the ribonuclease III family bind and cleave…
Q: 1. Where would the RNA polymerase II bind this piece of DNA = region B 2. What DNA sequence would…
A: 1. DNA polymerase 2 binds with the piece of DNA - B & A. Explanation - Region B is the - 80 CAAT…
Q: 1) Which of the following complexes contributes to the transcription of cyclin E? a) Cdk1/cyclin A…
A: 1) The cell cycle is a sequence of events that is occurring in a ordered fashion which results in…
Q: The following diagram represents DNA that is part of the RNA-coding sequence of a transcription…
A: Transcription is a process through which the template strand of DNA transcribes into mRNA with the…
Please do all.
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- 1. Which of the following repair mechanisms can lead to frameshift mutations? a. Nonhomologous end-joining b. Nucleotide excision repair c. Mismatch repair d. Homologous recombination 2. In eukaryotes, what must be formed before translation is initiated? a. The binding of 30s ribosomes with IF1, IF3, mRNA, and fmet-tRNAf b. The binding of 40s ribosomes with eIF1, eIF3, mRNA, and fmet-tRNAf c. The binding of 50s ribosomes with IF1, IF3, mRNA, and fmet-tRNAf d. The circularization of mRNA and subsequent binding with the complex made up of 40s ribosomes with eIF1, eIF3, and met-tRNAi. 3. Which of the following eukaryotic transcription initiation factors is correctly paired with their function? a. TFIID recruits RNAPII to the promoter b. TFIIA binds to the TATA box. c. TFIIF kicks out the inhibitory protein in TFIID. d. TFIIH melts the DNA to open the transcription bubble.4. Some transposases use extensive DNA replication to leave one copy of the element behind in a process called ____________________.A. persistent transpositionB. chronic transpositionC. exchange transpositionD. replicative transpositionE. none of the above 5. Which of the following is not an example of a transposable element found in bacteria?A. Tn5B. Tn10C. IS1D. IS903E. Xis 6. Besides a transposase, many common composite transposons in bacteria encode genes for:A. Toxin productionB. Antibiotic resistanceC. DNA repairD. Homologous recombinationE. None of the above1. This complex assembles and organizes nucleosomes and contributes to gene repression Group of answer choices a. SWR1 Complex b. ISWI Complex c. SWI/SNF Complex d. SWI Complex 2. A DNA lesion occurring when the deoxyribose molecule loses an adenine or a guanine base. Group of answer choices a. Depurination b. Deamination c. Depyrimination d. Denaturation 3. The difference between a nucleoside and nucleotide is: Group of answer choices a. Nucleotides contains deoxyribose sugar and nucleosides contain ribose sugar b. A nucleoside consists of the sugar with a nitrogenous base, whereas a nucleotide has sugar with a nitrogenous base and phosphate groups attached to the sugar. c. A nucleotide consists of the sugar with a nitrogenous base, whereas a nucleoside has sugar with a nitrogenous base and phosphate groups attached to the sugar. d. Nucleotides are involved in eukaryotic DNA replication, while nucleosides are used in bacterial DNA replication
- 1)Which of the following would represent mRNA for the above minigene? a.) AUG CGC GUU CCC GUG UAA b.) UUA CAC GGG AAC GCG CAU c.) AAU GAG CCC AAG CGC GAU 2) Of the following types of RNAi, which one is the most stable? piRNA, miRNA, siRNA, circRNA 3) Identify sense from antisense in this fake minigene. 5’TTA CAC GGG AAC GCG CAT3’ 3’AAT GTG CCC TTG CGC GTA5'1. In DNA amplification, using the Taq polymerase, what is the maximum number of amplification cycles? a. 30 b. 20 c. 60 d. 10 2. In the case of trp operon, for transcription to fully occur, which of the following conditions must be met? a. Environmental tryptophan level must be low. b. Environmental tryptophan must be absent. c. Environmental tryptophan level must be abundant. d. Both a and b are correct.The following diagram represents a transcription unit in a hypothetical DNA molecule. 5′ … TTGACA … TATAAT … 3′ 3′ … AACTGT … ATATTA … 5′ a. On the basis of the information given, is this DNA from a bacterium or from a eukaryotic organism? b. If this DNA molecule is transcribed, which strand will be the template strand and which will be the nontemplate strand? c. Where, approximately, will the transcription start site be?
- 1.A portion of an mRNA attached to a ribosome reads: 5′ GACAUGAACAGC 3′ If a tRNA with a methionine amino acid attached is in the P site of the ribosome, a tRNA with which amino acid attached will enter the A site? Group of answer choices a. Glutamic Acid b. Lysine c. Threonine d. Asparagine 2. Active transcription does not occur in regions of chromatin loops that are located ________. Group of answer choices a. A large distance away from the MARS b. Within the euchromatin c. Near the MARS d. A large distance from the telomere 3. Given the DNA sequence 5′-AUG GCU AGA GUU GAA AAA-3′, which of these sequences represents a silent mutation? Group of answer choices a. 5′-AUG GUU AGA GUU GAA AAA-3′ b. 5′-AUG GCU UGA GUU GAA AAA-3′ c. 5′-AUG GCU AGA GUU GGA AAA-3′ d. 5′-AUG GCU CGA GUU GAA AAA-3′1. Classify the type of mutation that have taken place: silent, missense and nonsense as a result of a single base substitution from UCG codon which codes for cysteine:a) AGC (ser): ________b) UGU (cys): ________c) GGC (gly): _______d) UGA (stop): _______e) UUC (phen): _______2. A single base addition and a single base deletion approximately 15 bases apart in the mRNA specifying the protein lysozyme from the bacterial virus T4 caused a change in the protein fromits wil-type composition….lys-ser-pro-ser-leu-asn-ala-ala-lys…..to the mutant form lys-val-his-his-leu-met-ala-alalys.a. Decipher the segment of mRNA for both the original protein and the double mutant.b. Which base was added? Which was deleted?3. Given is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the red blood cells): 5’ TAC-CAC-GTG-GAC-TGA-GGA-CTC-CTC-TTC-AGA 3’a. What is the complementary strand?b. Deduce the mRNA in this coding region.c. What is the amino acid sequence based on this…RNA polymerases generally require a primer to begin transcription. (T) (F) The Death Cap Mushroom Amanita phalloides is toxic because of its ability to produce alpha-amanitin, which is an inhibitor of RNA Polymerases I and III. (T) (F) In bacteria, transcription and translation can occur simultaneously. (T) (F) In eukaryotes, transcription and translation can occur simultaneously (T) (F) RNA polymerase II has no form of proofreading activity. (T) (F) Sigma factors specify binding of bacterial RNA Polymerases to specific promoters (T) (F) An E. coli strain with mutations in genes encoding both the dam methylase and the RecA protein would likely be inviable (dead) (T) (F) An E. coli culture grown in a pure (100%) N2 atmosphere would likely have a lower rate of mutations than a culture grown under normal conditions (~30% O2 and 70% N2) (T) (F) Non-homologous end joining repairs double strand DNA breaks with no loss of information, restoring the original…
- 1. (a) Which of the following statements is TRUE? DNA polymerase moves in a 5 to 3 direction in proofreading and correcting synthesized DNA. RNA polymerase moves in a 5 to 3 direction in synthesizing mRNA. Ribosome moves in a 3 to 5 direction during translation. tRNA moves in a 3 to 5 direction during translation. (b) "In this mutation, most amino acids are replaced due to a deletion of a nucleotide base." missense mutation nonsense mutation silent mutation frameshift mutationChoose 1 or more than 1 RNA are extracted from liver cells and separated in agarose gel by electrophoresis side-by-side with a molecular weight marker. The separated RNA fragments are then transferred to an RNA-binding membrane. Next, this membrane is incubated with labelled probe specific for the gene X. This experiment determines: how many copies of gene X there are in liver cells. if the gene X is translated in liver cells. if gene X has a point mutation in liver cells. the chromosomal location of gene X. the length of the transcript of gene X.1) Which of the following complexes contributes to the transcription of cyclin E? a) Cdk1/cyclin A b) Cdk2/cyclin B c) Cdk3/cyclin C d) Cdk4/cyclin D 2. DNA Polymerase δ (delta) has the following functions EXCEPT a) proof-read the new DNA strand. b) detach the dangling RNA primer. c) nip the RNA primer during termination. d) add DNA nucleotides to the lagging strand.