A260 of a DNA was found to be high. It was not affected by an increase in temperature. Why? renaturing dna by allowing strands to hybridize is also called ——• he amino acids which are dominant in proteins that bind to dna are the nucleoside that is composed of deoxy ribose linked to a guanine
Q: The beta-branched OH amino acid depicted below is: O OH NH₂ OL-L Isoleucine
A: Threonine and isoleucine both have almost similar structure , the only difference is in their side…
Q: As soon as lysis occurs, proteolysis, dephosphorylation and denaturation begin. These events can be…
A: Cell lysis is a process in which cells membrane are ruptured and all constituents are released. It…
Q: may I ask how you get 12-65 of the leptin's size?
A: Leptin is a protein (hormone) of size 16 kDa (167 amino acids) which is released from the fat cells…
Q: A radiolabeled glucose solution is utilized as a nutrient source for a human myocyte in order to…
A: Glucose is the most favored respiratory substrate for most forms of life and myocytes (muscle cells)…
Q: Please state if the statements are true or false. 1. Xylose is a pentose and a ketose 2. Louis…
A: Xylose is a sugar. Sugar molecules are also known as carbohydrates. Carbohydrates are composed of…
Q: Prepare a 75 ml of a 10% (w/v) FeCl3 solution. How many grams of FeCl3 must be weighed out and…
A: Given Values: Volume of FeCl3 solution = 75 ml Concentration of the FeCl3 = 10% (w/v)
Q: Give one condition for the denaturation step employed in blotting.
A: one condition for the denaturation step employed in blotting
Q: "Using the concepts and techniques you have learned from the two labster simulations, provide…
A: Monogenic disorders are those disorders that occur due to a single non-functional gene in our body.…
Q: Calculate the unknown concentration of the PROTEIN C with an absorbance value of A412 given the…
A: Protein concentration can be determined with the help of spectroscopy. Spectrophotometer is an…
Q: 3-phosphoglycerate serves as the precursor of the glycerol backbone during TAG biosynthesis. True…
A: All eukaryotic organisms and even a few prokaryotes are able to synthesize triacylglycerol. The…
Q: TAG
A: The conversation of biomolecules to its molecule is called conversation.
Q: How does a cell maintain theright amount of every component(organelles, molecules), and how doesit…
A: Cell organelles and molecules are usually not randomly distributed , they are localized where they…
Q: How is ATP produced in Glycolysis? Kreb Cycle? Electron transport system?
A: Glycolysis is the metabolic pathway in which glucose is oxidized into pyruvate. The citric acid…
Q: Are tRNAfmet and tRNAmet made from the same aminoacyl tRNA synthetase?
A: Amino acyl tRNA synthase pairs tRNA with amino acid that their anti codon codes for. Amino acyl tRNA…
Q: What TYPE of inhibition is observed in the following plot: 1/v₂ Intersect at Y axis 1/Km Competitive…
A: Enzymes can be inhibited , when the substrate and inhibitor compete for the binding to the same…
Q: Consider the following figure when answering this question. Answer all of the questions on your own…
A: Monosaccharides are identified as one of the simplest carbohydrates. These compounds can not be…
Q: Discuss briefly but concisely the importance of the following metabolic pathway. A. Glycolysis B.…
A: Different metabolic pathways occurs in the living cell like glycolysis, Krebs cycle, Electron…
Q: Does a carbohydrate rich meal promotes glycogenesis?
A: The method of producing glycogen from glucose is known as glycogenesis. Glycogenesis is the process…
Q: If I want to make a 100mL buffer that has 2% SDS, 100mM tris pH 8, 10mM EDTA, and proteinase K…
A: Introduction: Buffer is defined as a solution that resists change in pH on the addition of acid or…
Q: 2. Peter does not tolerate lactose in milk. He bought a solution of ß-galactosidase where [Eo] 10.0…
A: First lets find the Vmax value of the enzyme β-galactosidase. Vmax = Kcat×Etotal =525 s-1…
Q: If there is an accumulation of acetyl CoA in the liver mitochondria, acetyl CoA is converted to…
A: Acetyl CoA is the end product of carbohydrate, lipid, and protein metabolism. The acetyl CoA…
Q: rearrange these in the correct order of events in an action potential.
A: The process of impulse transmission involves two stages known as resting membrane potential and…
Q: Please dont copy Summarize the phases of oxidative phosphorylation starting with ETC receiving…
A: The final step in cellular respiration is oxidative phosphorylation. It takes place in the…
Q: What TYPE of inhibition is observed in the following: S E S
A: A chemical that binds to an enzyme and inhibits its activity is known as an enzyme inhibitor.…
Q: Which of the following statements is TRUE about cholesterol biosynthesis? Group of answer choices…
A: Cholesterol biosynthesis pathway involves the conversion of the Acetyl CoA to the Acetoacetyl CoA…
Q: What is the net electric charge of a peptide that has the sequence and provide the one letter code…
A: The amino acids are composed of an amino group, a carboxyl group, a hydrogen atom, and a variable…
Q: What are the x and y values that you have input in the excel? I thought the x would be from the…
A: Proteins are composed of amino acids, coomassie brilliant blue dye binds to basic amino acids of the…
Q: deduce the DNA sequence based on the following electrophoreograms.
A: The electrophoretic technique is used to separate proteins, DNA, and RNA based on their size and…
Q: what will happen if there is an accumulation of acetyl CoA in the liver mitochondria?
A: Acetyl coenzyme A is a thioester between the acyl group carrier, acetic acid, and a thiol that acts…
Q: Section A – Answer ALL questions A 1 month old baby is failing to thrive, with poor feeding and…
A: To measure rate of reaction we measure either the rate of consumption of the substrate, where the…
Q: Which of the following statements is FALSE? Group of answer choices: - Plastoquinone has a higher…
A: Photosynthesis is the process by which plants utilise light energy from the sun to prepare food and…
Q: Consider the complete oxidation of one mole of simple TAG containing behenic acid residues (22:0).…
A: TAG contains a glycerol backbone attached to three molecules of behenic acid through ester bonds. It…
Q: In CO2 assimilation of C4 plants, the acceptor molecule is oxaloacetate. Group of answer choices:…
A: In C4 plant , CO2 assimilation occur via C4 cycle, also known as Hatch- Slack pathway.
Q: Make a mind map of CELLULAR RESPIRATION and PHOTOSYNTHESIS. From this main concept, you will branch…
A: Photosynthesis makes the glucose and oxygen from CO2 and H2O that by product glucose is used in…
Q: Calculate the unknown concentration of the PROTEIN A with an absorbance value of A188 given the…
A: By using the given protein concentration, one has to make the standard plot. The standard plot…
Q: Which of the following is true about how enzymes work in the cell? A. Enzymes are consumed in the…
A: Proteins that catalyze biological reactions are known as enzymes. They catalyze several body…
Q: During Krebs cycle, the conversion of isocitrate to alpha-keto glutarate involves all of the…
A: Isocitrate to alpha-keto glutarate: Via enzyme isocitrate dehydrogenase
Q: Glucagon
A: The statement is false.
Q: escribe the catalytic reaction mechanism of the enzyme acetylcholinesterase. Discuss the functional…
A: Acetylcholinesterase(AChE) is an enzyme found in the synapses between nerve cells and muscle cells.…
Q: What are the application of human genome(not human genome project) into health, biochemistry, and…
A: Human genome comprises of human's nucleic acid sequences that are encoded only in form of DNA. This…
Q: B) Phosphate buffer is often used to buffer biological systems. Phosphate has three relevant pK,…
A: The given pKa values of the H3PO4 are 2.14, 6.86, and 12.40. pKa value is the pH at which the…
Q: What is the pH of a buffer prepared by adding 30.0 mL of 0.25 M acetic acid (CH₂COOH) (K. = 1.7 x…
A: The pH of a buffer prepared by adding 30.0 mL of 0.25 M acetic acid to 125.0 mL of 0.15 M sodium…
Q: Identify (1) the group where the lipid belongs, and (2) determine whether the lipid is saponifiable…
A: The given structure is of Cortisol also known as hydrocortisone. A saponifiable lipid is part of the…
Q: What structural characteristics are common to all the amino acids that are found in mammalian…
A: Amino acids are the monomer units of a protein. Structurally amino acids are similar in all living…
Q: Please answer fast 1. It summarizes in chronological order the most important events that represent…
A: The viruses have originated in the evolutionary history in a very unclear way. Some viruses may have…
Q: A researcher has measured the initial rate of an enzyme-catalyzed reaction as a function of…
A: Km and Vmax are important features of an enzyme thatvcan determine the efficiency of the enzyme.…
Q: 3. Fill in the missing molecules or required cofactors. PLP b) @NH₂ OH
A: Hi! Thank you for the question. We are authorized to answer three subparts at a time, since you have…
Q: Define the pedigree symbol(s) associated with each of the following individuals. Please be as…
A: Pedigree: Pedigree is a family tree that is used to show the mode of inheritance of genetic traits/…
Q: Why is ammonia highly toxic?
A: Ammonia toxicity occurs when individuals are exposed to external sources of ammonia via ingestion,…
Q: Why do you think you need to add NaCl?
A: Hi! Thank you for the question. We are authorized to answer three subparts at a time, since you have…
Step by step
Solved in 3 steps
- Given the choices,a. 25b. 18c. 23d. 21how many hydrogen bonds are present in a DNA double helix fragment consisting of the following sequence in one strand: ATTGCGGTCAThe technique of dideoxy sequencing of DNA is described inChapter 20. The technique relies on the use of dideoxyribonucleotides(shown in Figures 20.5 and 20.16). A dideoxyribonucleotidehas a hydrogen atom attached to the 3′-carbon atom insteadof an –OH group. When a dideoxyribonucleotide is incorporatedinto a newly made strand, the strand cannot grow any longer.Explain why.The complementary strands of DNA in the double helixare held together by hydrogen bonds: G ≡ C or A = T.These bonds can be broken (denatured) in aqueous solutions by heating to yield two single strands of DNA(see Figure 1-13a). How would you expect the relativeamounts of GC versus AT base pairs in a DNA doublehelix to affect the amount of heat required to denatureit? How would you expect the length of a DNA doublehelix in base pairs to affect the amount of heat requiredto denature it?
- Which conformation of DNA – (i) totally double helix, (ii) minimally unwound or (iii) largely unwound – would have the highest relative absorbance at 260 nm. Would a molecule of DNA having a higher content of guanine and cytosine than of adenine and thymine have a higher or lower melting temperature (Tm) than one with the reverse composition?When a double-stranded DNA molecule is exposed tohigh temperature, the two strands separate, and themolecule loses its helical form. We say the DNA hasbeen denatured. (Denaturation also occurs whenDNA is exposed to acid or alkaline solutions.)a. Regions of the DNA that contain many A–T basepairs are the first to become denatured as the temperature of a DNA solution is raised. Thinkingabout the chemical structure of the DNA molecule, why do you think the A–T-rich regionsdenature first?b. If the temperature is lowered, the original DNAstrands can reanneal, or renature. In addition to thefull double-stranded molecules, some molecules ofthe type shown here are seen when the moleculesare examined under the electron microscope. Howcan you explain these structures?The sequence of a region of interest in a DNA template strand is3′–ATACGACTAGTCGGGACCATATC–5′. If the primer in a dideoxysequencing experiment anneals just to the left of this sequence, drawthe sequencing ladder that will be obtained.
- which type of base pairs uf any allow the dna to remain double dtranded at higher temperature? gc at both neither3’atgtaccatgcgcaaatttaaaggccc5’. a) Using this single template strand of a DNA as a template, write the base sequence of the complementary strand. b) List the molecules must be present for DNA to be replicated and briefly describe their function.The sequence of the DNA template strand is 3’– GACTTCC – 5’ What is the sequence of the DNA informational strand?
- he bases of one of the strands of DNA in a regionwhere DNA replication begins are shown at the endof this problem. What is the sequence of the primerthat is synthesized complementary to the bases inbold? (Indicate the 5′ and 3′ ends of the sequence.)5′ AGGCCTCGAATTCGTATAGCTTTCAGAAA 3′Suppose you are a research assistant ina lab studying DNA-binding proteins. You have been giventhe amino acid sequences of all the proteins encoded bythe genome of a certain species and have been asked to findcandidate proteins that could bind DNA. What type of aminoacids would you expect to see in the DNA-binding regions ofsuch proteins? Explain your thinking.Is it unusual that the -subunits of DNA polymerase III that form a sliding clamp along the DNA do not containthe active site for the polymerization reaction? Explain your answer.