15.3 Explain the fellovine diaeram: prospective nuclear protein nuclear Ran HYDROLYZES ITS BOUND GTP, localization Ran-GDP ignal Ran-GDP DISSOCIATES PROTEIN BINDS FROM RECEPTOR TO RECEPTOR nuclear pore CYTOSOL NUCLEUS Ran-GTP BINDS PROTEIN DELIVERED TO NUCLEUS TO RECEPTOR Ran-GTP 15.4 EXplain the followine.diBEram: SRP displaced and released for reuse MRNA ribosome signal- recognition particle (SRP) CYTOSOL growing- polypeptide chain ER signal sequence ER LUMEN SRP receptor protein translocator Ngam 1514 Iereoog ed.arinde 15.5 Explain the following.diaeram: newly synthesized soluble proteins for constitutive newly synthesized plasma membrane lipids transport vesicde secretion CONSTITUTIVE SECRETION unregulated exocytosis plasma membrane newly synthesized plasma membrane protein extracellular signal such as trans Golgi network homone or neurotransmitter signal transduction REGULATED SECRETION regulated екосуtosis secretory vesicle storing secretory proteins Golgi apparatus CYTOSOL EXTRACELLULAR SPACE Rigua 5a Intil olog d. arat Sc

Q: If the following truncated peptide represents the active domain of the COVID19’s S-protein…

A: Mutations are alterations in the DNA sequence of an organism. Small changes, such as adding or…

Q: Understanding why these receptors are present when they are not supposed to be is important in…

A: When there is methylation at the cytosines present in promoter the genes are silenced as they blocks…

Q: Two proteins have exactly the same amino acid sequence. Protein A is able to bind with high affinity…

A: Only certain substances can diffuse through the cell membrane as the cell membrane is selectively…

Q: 9 of 16 In a signal transduction pathway involving G protein-coupled receptors, the receptor first…

A: GPCR stands for G protein coupled receptor. They are membrane bound transmembrane proteins. The…

Q: Draw the SMN2 pre-mRNA (SMN2 has 10 exons and 9 introns), indicate the 5’ and 3’ SS location. [2pts]

A: Spinal muscular atrophy (SMA), which results from the deficiency of articulation of the endurance of…

Q: The transphosphorylation of STAT proteins by Jannus Kinase causes: a. formation of STAT heterodimers…

A: Solution - c is correct option- formation of stat heterodimer which act as transcription factor.

Q: Now read this abstract from a 2013 journal article What is the authors' explanation of how Gal80p…

A: In the present system, GAL genes in Saccharomyces cerevisiae are regulated by the combined action of…

Q: The retinoblastoma tumor suppressor gene Rb (RB1) codes forthe retinoblastoma protein (pRB). pRB…

A: Retinoblastoma is a tumor suppressor gene during cancer progression, loss of function of tumor…

Q: Briefly describe the following properties of the Ras GTPases: a) Size, structure and cellular…

A: a) Mature ras protein are located on the inner side of the plasma membrane, and their biochemical…

Q: Figure 1 represents the amino acid sequence of a G-protein coupled receptor (GPCR) as determine by…

A: Amino acids are the building units of a protein. Amino acids are linked together by a peptide bonds…

Q: Identify three key ways that TrXG genes promote transcription

A: In the metazoans the TrXg genes help in the regulation of the developmental processes along with the…

Q: What critical roles does the TFIIH CTD kinase play in regulating the switch from a pre-initiation…

A: Hi, Thanks For Your Question.  Answer : TFIIH Is Required For The Beginning And Transition To…

Q: A certain nonsense suppressor corrects a nongrowingmutant to a state that is near, but not exactly,…

A: A nonsense suppressor mutation can influence the effects of nonsense mutations. It is usually a…

Q: I. The retinoic acid receptor (RAR) is a transcription factor that is similar to steroid hormone…

A: The retinoic acid receptor is a kind of receptor which can act as transcription receptor. There are…

Q: Identify the ligand that bind to uniprotkb-P39086, the type of allostery, and describe the general…

A: P39086 is an ID for a protein GRIK1_HUMAN that belongs to Homosapiens. It is a protein of 918 amino…

Q: Homozygosity for extremely rare mutations in a humangene called SCN9A cause complete insensitivity…

A: The SCN9A gene encodes for a sodium ion channel that is dependent on voltage. It is composed of 26…

Q: Signal Molecule- Somatostatin Receptor Name- Somatostatin receptor type 2 Draw the structure of the…

A: Somatostatin is a peptide hormone secreted by the δ cells of pancreas. The signal molecule here is…

Q: Define the following terms:a. cotranslational transferb. posttranslational transferc. TOM receptor…

A: "Since you have posted a question with multiple sub-parts, we will solve the first three sub-parts…

Q: Predict and explain the effect on GAL1 transcription, in the presence of galactose alone, of the…

A: Note: Hi! Thank you for the question. As per the honor code, we are allowed to answer three…

Q: EF-Tu, a member of the G-protein family, plays a crucial role in the elongation process of…

A: Protein synthesis is a process through which genes in the DNA are transcribed into mRNA and through…

Q: Match the given step with the major central dogma event being referred to. The U2 snRNP binds to the…

A:

Q: Polypeptides with the ER Signal Sequence (MMSFVSLLLVGILFTATEAEQLTKCEVFQ <- one-letter amino acid…

A: Proteins are synthesized in the cytosol in a process called translation. RNA polymerase and other…

Q: T7-MDM2 Myc-RYBP p53-(His-Ub), MDM2 p53 Myc-RYBP B-Actin QUESTION 12 In the RYBP case study paper,…

A: *Ring1 and YY1 binding protein (RYBP) belongs to polycomb group proteins that implicated in…

Q: gene for a eukaryotic polypeptide 300 amino acid residues Iong is altered so that a signal sequence…

A: Polypeptide is synthesized by using ribosomes attached on endoplasmic reticulum ( rough endoplasmic…

Q: Briefly describe the following properties of the Rab and Arf GTPases: a) Size, structure and…

A: Hi, thank you for posting the question on Bartleby. As per the guidelines, we can answer only one…

Q: If a cell cannot make any Rb protein, how will this affect the function of E2F?

A: Mutation in the deoxyribonucleic acid (DNA) can cause cancer. Abnormal and unnecessary growth of…

Q: SH2 domains in relay proteins specifically bind to __________. Gα-GTP Ca2+ions cAMP glucagon…

A: SH2 domains is  a protein domain which is structurally conserved is within Src oncoprotein. These…

Q: The tumor suppressor pRB also binds to and suppresses the activity of retinoblastoma-binding protein…

A: Mutation in genes is the process of change in the nucleotide sequence of the genome.

Q: Why do Receptor Tyrosine Kinases have to form a dimer?

A: Receptor tyrosine kinases are cell-surface receptors that respond to hormones. These receptors…

Q: Explain why the RTK signaling pathway includes the extra complication of having a protein (Ras) that…

A: Ras is a tiny GTP-binding protein that is part of the signal transduction pathway that growth…

Q: 8. Explain the steps that lead to phosphorylation (activation) of Akt by EGFR receptor.

A: *NOTE: Kindly repost for other questions Dear Student as per the guidelines we are supposed to…

Q: 8. Describe the MAP kinase activation pathway

A: Protein kinases and other messenger systems form highly interactive networks to achieve the…

Q: Some elongation factors are evolutionarily related to the G-proteins involved in signal…

A: The elongation factors and the G proteins are evolutionary related. both of them utilise the high…

Q: In Figure 6-19,a. what do the square/triangular pegs and holesrepresent?b. is the suppressor…

A: Mutation is a permanent change in the genetic material (the genome) of a cell of a live creature or…

Q: ) One of the main differences between receptor tyrosine kinase (RTK) signaling and G-protein coupled…

A: G protein coupled receptors are the large family of cell surface receptors that are involved in the…

Q: Discuss the key factors & mechanisms during co-translational translocation by which START TRANSFER…

A: INTRODUCTION co translational translocation Co-translational translocation of a protein means the…

Q: Mhich of the following polypeptides is coded for my the MRNA sequence 5' AUGGUUAAACGACAAUCC 3 ?

A: The amino acids are selected and wrote in the sequence as first, second and third base. The process…

Q: Effects of BPA on phosphorylation of MAPK family in RAW264.7 cells conclusion

A: Bisphenol A or BPA is one of the key component of polycarbonate plastics and it causes a wide range…

Q: A ligand called TIIF binds to arginine-127 (R127 in transmembrane helix 3(TMH3) to cause the…

A: GPCR (G-protein coupled receptor) is a seven-transmembrane receptor found on the cell surface. GPCR…

Q: How would a mutation that prevents the Ras proteinfrom hydrolyzing GTP affect the cell-signaling…

A: Ras is a family of the protein, which belongs to the GTPases. It helps in the transmitting signals…

Q: Consider the now dominant variant of the SARS-CoV-2 called the D614G mutation: (C) Spike…

A: Mutations are the abrupt changes in the DNA which may be harmful or beneficial to the organism in…

Q: Pathway analysis: Link the protein names to the correct statements by interrogating the depicted…

A: No process within life forms are more intricated than the interconnected signal transduction…

Q: Comparison of 1IR3 and 1IRK shows that the tyrosine kinase domainfrom dimer, and that the…

A: insulin receptors are the transmembrane receptors they are activated by the insulin they belong to…

Q: GTTTTCACTGGCGAGCGTCATCTTCCTACT 8. What is the function (e.g. transcriptional regulation,…

A: This is a nucleotide sequence of a DNA as it contains four types of nitrogenous bases Adenine,…

Q: Spliceosomes include all of the following EXCEPT   enzymes catalyzing acetylation of histone…

A: Introduction: The splicing of RNA occurs by a large complex known as the spliceosome. It contains…

Q: Some events that occur during the expression of a neuronal glutamate receptor protein are listed…

A: The sequential events that occur during the expression of neuronal glutamate receptor protein are…

Q: Which factor has NOT been shown to play a role in determining the specificity of protein kinases?…

A: The protein kinase is an enzyme associated with the phosphorylation of protein by adding phosphate…

Q: A single mutation in one of the transcription factors inProblem 33 results in a drastic reduction in…

A: Introduction A mutation occurs when the sequence of DNA changes. Mutations can occur as a result of…

Q: Why is it important that the approximately 60 different Rab GTPases in humans are associated with…

A: Rab GTPases-It is the main regulator of eukaryotic membrane transport. GTPases-Guanine…