2 of 22 The direction of synthesis for a new MRNA molecule is from a template strand, and this corresponds to the terminus of the protein. O 5' to 3'; 3' to 5', N to C O 5' to 3'; 5' to 3', N to C 5' to 5'; 3' to 5', N to C 3' to 5'; 5' to 3', C to N O 3' to 5'; 3' to 5', C to N

2 of 22 The direction of synthesis for a new MRNA molecule is from a template strand, and this corresponds to the terminus of the protein. O 5' to 3'; 3' to 5', N to C O 5' to 3'; 5' to 3', N to C 5' to 5'; 3' to 5', N to C 3' to 5'; 5' to 3', C to N O 3' to 5'; 3' to 5', C to N

Name: 2 of 22The direction of synthesis for a new MRNA molecule isfrom atem
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: 2 of 22The direction of synthesis for a new MRNA molecule isfrom atemplate strand, and this corresponds to theterminus of the protein.O 5' to 3'; 3' to 5', N to CO 5' to 3'; 5' to 3', N to C5' to 5'; 3' to 5', N to C3' to 5'; 5' to 3', C to NO 3' to

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter15: Genes And Proteins

Section: Chapter Questions

Problem 15RQ: A scientist identifies a pre-mRNA with the following structure. What is the predicted size of the...

See similar textbooks

Similar questions

Discuss Concepts The normal form of a gene contains the nucleotide sequence: When this gene is transcribed, the result is the following mRNA molecule: In a mutated form of the gene, two extra base pairs (underlined) are inserted: What effect will this particular mutation have on the structure of the protein encoded in the gene?
Which of the following statements is false? a. GTP is an energy source during various stages of translation. b. In the ribosome, peptidyl transferase catalyzes peptide bondformation between amino acids. c. When the mRNA code UAA reaches the ribosome, there isno tRNA to bind to it. d. A long polypeptide is cut off the tRNA in the A site so its Metamino acid links to the amino acid in the P site. e. Forty-two amino acids of a protein are encoded by 126nucleotides of the mRNA.
A scientist identifies a pre-mRNA with the following structure. What is the predicted size of the corresponding mature mRNA in base pairs (bp), excluding the 5' cap and 3’ poly-A tail? 220bp 295bp 140bp 435bp
A scientist mutates elF-2 to eliminate its GTP hydrolysis capability. How would this mutated form of elF-2 alter translation? Initiation factors would not be able to bind to mRNA The large ribosomal subunit would not be able to interact with itiRNA transcripts tRNAi-Met would not scan mRNA transcripts for the start codon elF-2 would not be able to interact with the small ribosomal subunit.
A scientist introduces a mutation that makes the 60S ribosomal subunit nonfunctional in a human cell line. What would be the predicted effect on translation? Translation stalls after the initiation AUG codon is identified The ribosome cannot catalyze the formation of peptide bonds between the tRNAs in the A and P sites The ribosome cannot interact with mRNAs tRNAs cannot exit the E site of the ribosome.
1. What is the nucleotide sequence of the mRNA transcribed from the template DNA strand: 3’-GCTACAAAAAGTCCATAATCGC-5’? Indicate the 5’ and 3’ ends. Follow the same format as the given sequence. 2. If the mRNA sequence you obtained in question 2 were to be translated, what would be the sequence of amino acids in the peptide? Use the 3-letter code of the amino acids. Separate the amino acids with a dash (-). NO NEED to indicate the N- and C-terminal amino acids. Assumption is that the first amino acid is the N-terminal. 3. If the mRNA sequence you obtained in question 2 were to be translated, what would be the sequence of amino acids in the peptide? Use the 3-letter code of the amino acids. Separate the amino acids with a dash (-). NO NEED to indicate the N- and C-terminal amino acids. The assumption is that the first amino acid is the N-terminal.
17. All of the following occur when the amino acids of two tRNA molecules are joined, except. a. The tRNA in the first position is released to get a new amino acid b. The mRNA molecules bring amino acids to the ribosome to be joined to the growing polypeptide c. The growing polypeptide is attached to the tRNA in the second position d. The mRNA is pulled through the ribosome so that the tRNA with the protein chain goes into the first position
3. A life-form from another universe is found to have nucleic acid which includes six different bases - R, S, T, X, Y and Z. The percentage composition of R, S and T is always the same, and the percentage composition of X, Y and Z is always the same. Propose a reasonable hypothesis regarding the structure of the nucleic acid. 4. Describe how mRNA is formed and how it is modified before being released from the nucleus of the cell.
4.) what is the amino acid chain that your answer in item 2 will dictate? Question in Item 2: The complementary strand from item 1 undergoes transcription. What will be its mRNA complementary strand? Answer : The mRNA complementary strand from this complementary strand obtained from item 1 should be:AAGUUUCGCCCCGGG. 5.) Suppose that the amino acid chain in item 4 is altered. In what stage replication, transcription, or translation) could an error have occured? Explain your answer using the template DNA from item 1. Question in item 1 : if a DNA template with the sequence AAGTTTCGCCCCGGG undergoes replication, what will be its complementary DNA strand? Answer : According to complementary base pairing rules, A is complementary to T and G is complementary to C. Hence the complementary DNA strand should be:TTCAAAGCGGGGCCC
1. What mRNA sequence is synthesized from a section of DNA that is 3’-TTGACCT-5’? 2. In what direction does a polymerase move when synthesizing a strand of mRNA? 3. Define transcription and translation. Which process occurs first to make protein from DNA?
7. A segment of a DNA strand consists of ...GCTTAGACCTGA.... (a) Identify the expected nucleotide order in the complementary mRNA (b) Identify the sequence of amino acids coded for by this segment of DNA. (c) Describe the bond that forms during translation to link amino acids together. Identify the functional groups that react and the atoms involved.
5’ AGGATCAACACCTGTACATGG 3’ 3’ TCCTAGTTGTGGACATGTACC 5’ Label the sense and antisense strands and what direction will the RNA polymerase travel to make the mRNA? Transcribe the DNA into mRNA (Include polarity)and translate the mRNA into a polypeptide chain (Include polarity)