21. Which of the following mutations would be expected to have the most harmful effect on the resulting protein? a. a three-base addition near the stop codon b. a base deletion near the stop codon c. a base deletion near the start codon d. a base substitution

Q: 3. An alteration of genetic information is shown below. A-G-T-A-C-C-G-A-T → A-G-T-G-A-T What type of…

A: Alteration of genetic information shown below is an example of Deletion Mutation.  In the given…

Q: 2. Complete the leading strand and the complementary strand vith the 5'and 3' ends and identify he…

A: DNA replication is the process by which a new DNA molecule is formed and this process is known as…

Q: II. Give the translation of the segment of a polypeptide chain below. Specify your template strand.…

A: The template strand is a DNA strand that functions as a template for the synthesis of complementary…

Q: Translation is the flow of information from: a) DNAàDNA b) DNAà mRNA c) mRNAà polypeptide d)…

A: Introduction  Genome consists of DNA/RNA which consists of nucleotides either deoxyribose…

Q: 5)Which type of nucleic acid would have the sequence "ACCGAUUG"? a)DNA b)mRNA c)Another type of…

A: Carbohydrates, amino acids, fats, and nucleic acids are the most important biomolecules found in…

Q: 2. What happens during translation? is read and Possible sentence frame: Translation is the process…

A: The protein synthesis occurs in cytoplasm by the process of translation.

Q: 5. A DNA sequence of "ACG" will code for the amino acid - (LS1- 1) * Second mRNA base C. UUU Phe UUC…

A: Gene expression refers to the complex, highly-regulated biological process, which involves the…

Q: 4. The template strand from the previous question is mutated to the DNA sequence shown below: 3' GTC…

A: transcription is the process by which messenger rna is made from dna .

Q: 4. Compare the DNA sequences of individuals with Alzheimer's disease and their family members. Two…

A: The amyloid beta precursor protein (APP) is coded by the APP gene that is located on the chromosome…

Q: b) What is the MRNA sequence that would be created from the DNA template sequence above?…

A: Cell is the basic structural and functional unit of life. All the cells contains the nucleus with…

Q: 7) A strand of MRNA that is 450 nitrogenous bases long will produce a protein containing…

A: Living cells use a collection of rules called the genetic code to translate information found in…

Q: 9. Examine the image to the right, which represents a snapshot of translation. Which staan of…

A: Translation is the process of making proteins from RNA. Transcription is the process of making RNA…

Q: 4. In the following figure, mark the position of the start codon, polyA, and the promotor. DNA ORF

A: The DNA sequence codes for the mRNA. DNA sequence consists of all the necessary requirements for the…

Q: 7. Predict the bases that will pair with the following bases to form the complementary messenger…

A: There are basically 4 types of nitrogenous bases ATGC and in RNA thymine is replaced with Uracil.

Q: All of the following occur when the amino acids of two tRNA molecules are joined, except. a. The…

A: DNA replication, transcription, and translation are the molecular processes that are responsible for…

Q: o In Prokaryotes, what is the function of the 5'UTR? A. It contains the start codon It contains the…

A: The 5′ untranslated region (5′ UTR) is the region of an mRNA that is directly upstream from the…

Q: 1. Classify the type of mutation that have taken place: silent, missense and nonsense as a result of…

A: Introduction: The changes or alteration in the sequence of DNA is known as mutation.

Q: 7. Give all the possible Anti-codons for the amino acids listed below. Histidine (His) Isoleucine…

A: Codons is a sequence of three nucleotides that corresponds with a specific amino acid or stop signal…

Q: 1. What is called the functional unit of a DNA molecule that may code for RNA or protein? A. arnino…

A: DNA or deoxyribonucleic acid is the molecule that is made up of polynucleotide chains coiled around…

Q: 6. Describe transcription, include the following terms: mRNA, RNA polymerase, promoter, template…

A: "Transcription" and "Translation" are two important processes that take place inside the cell for…

Q: 1. One strand of DNA has the base sequence: CGATTGGCAGTCAT. Determine the sequence of bases in the…

A: The sequence of bases of complementary mRNA from DNA strand can be determined as follows: DNA  mRNA…

Q: 1. True or False a) DNA bases, when coiled to histones, become inaccessible to RNA polymerase. b)…

A: Transcription is the process by which the information of DNA are copied into mRNA and this process…

Q: 8. Which RNA molecule is NOT involved in the processes of transcription and translation? A.…

A: RNA or Ribonucleic acid is a type of nucleic acid. Transcription is the process of synthesis of…

Q: Briefly describe the function of the following in protein synthesis: a) rRNA, b) tRNA c) mRNA

A: Ribonucleic acid (RNA) is a genetic material that is prepared from the deoxyribonucleic acid (DNA)…

Q: 1. Using the central dogma of molecular biology, explain the terms replication, transcription and…

A: Since you have asked multiple questions, we will answer only the first question for you. If you want…

Q: 6) The diagram shows a strand of DNA matched to a strand of messenger RNA. MRNA is being made from…

A: Francis crick proposed central dogma which gives the flow of genetic information from DNA to RNA to…

Q: 11. Now imagine that a mutation occurred in the second T of the codon below and the T became a G.…

A: Introduction: The genetic macromolecule referred to as DNA is highly stable with regards to its base…

Q: A tRNA to which the correct amino acid has been attached is called

A: tRNAs bind to codons within the ribosome and deliver amino acids for the protein chain to be…

Q: 2. The rising of nanotechnology paved way to discover new trends, one of which is the discovery of…

A: The proteins are formed when ribosomes read an mRNA. The base triplets or codons on the mRNA are…

Q: 1. What is meant by the term ‘redundancy’ in the context of the genetic code? b) What are the…

A: Answer: DNA sequence is the sequence of nucleic bases arranged in an order which can able to read…

Q: 5. What mutation(s) would eliminate peptide translation? Nonsense mutation

A: In the given case, the sequence of DNA is given. The RNA contains uracil in place of thymine. Thus…

Q: 9) Which statement is inaccurate (wrong) about mRNA? A) it is double stranded and has thymine B) it…

A: The explanation for the wrong statement is given below.

Q: What are the components of the initiation complex for translation

A: Translation is a process in which codon of mRNA code for specific amino acid. These amino acid…

Q: SOURCE: GENERAL, ORGANIC AND BIOLOGICAL CHEMISTY by Smith 4th Edition

A: mRNA or messenger RNA is a polymer of ribonucleotides that has a sequence corresponding to the…

Q: 9. What is the purpose of the following? a) spliceosomes b) RNA polymerase c) Protein release…

A: The central dogma of molecular biology involves the processes of transcription and translation that…

Q: 3. The principle theme in biology is DNA transcribes to RNA and RNA translates to proteins. Place…

A: Introduction: The process of copying the genetic information from one strand of the DNA into RNA is…

Q: How many codons are there in the mRNA?

A: Here, the given original DNA sequence is: 5'ATGCCTGGACGCAATGCGAGCTGGCTTAACTCAGGGCGTTGA3' So,the mRNA…

Q: 1. Why is specific.base pairing essential to the process of transcription and translation? How many…

A: INTRODUCTION There are total 64 codons that code for a total of 20 amino acids. Out of the 64…

Q: 2. Do you think mutation has any direct relationship with codon? Why/Why not? Please explain in your…

A: Mutations are the errors, caused by changes in nucleotide bases inside codones. Two most common…

Q: Discuss the difference between intron and Exon

A: Exons are named as nucleic acid coding successions & they are available in mRNA. Introns are…

Q: 1. A DNA fragment was sequenced; however, the scatter-brained professor lost track of the direction…

A: In a transcription unit; the there are 2 DNA strands. The strand with polarity 3' to 5' is the…

Q: 8. Consider the following strand of mRNA. a. What would the original template DNA have been? b. What…

A: The central dogma of molecular biology is the metabolic process by which the DNA was converted into…

Q: 4. Which MRNA sequence complements the DNA sequence below? (LS1- 1) * A C SUP Sequence A O Sequence…

A: The DNA molecule in the cell stores the genetic information of the organism. But this information by…

Q: 1. One strand of DNA has the base sequence: C G A T T G G C A G T C A T. Determine the sequence of…

A: According to the question, one strand of DNA with the base sequence is given, we have to determine…

Q: 1. Convert the sequence from DNA to Amino Acids. 3-TCACCACTCTGGTCTGGTCATATCTGCCTGATATGAGTACAT - 5'…

A: The translation is a process in which the synthesis of protein is done from the mRNA. The sequence…

Q: 4. Mark the following statements about the genetic code as TRUE or FALSE: The genetic code is…

A: Genetic code is a set of three nucleotides where one triplet is called as one codon.

Q: 4. A mutation changes a nonsense codon to an amino acid sequence. Write an example of such a…

A: Mutation is any change in the sequence of DNA that causes a change in the protein that is…