2. Decode the hidden message from the polypeptide coded by the DNA sequence below. Express the amino acid sequence of the polypeptide using the one-letter notation. The DNA sequence given is in the 3' to 5' direction. CCGCTTTTACTCTGATAGACGAGTGGCGAAAATGAG ACTATCTGCTCA

Q: 3. An alteration of genetic information is shown below. A-G-T-A-C-C-G-A-T → A-G-T-G-A-T What type of…

A: Alteration of genetic information shown below is an example of Deletion Mutation.  In the given…

Q: Answer the following:  DNA fragment A is 3' AGC CCG CTC CGA GGC TAA AAG CGT 5' 1. is % of guanine…

A: The central dogma of life is that DNA self replicates to form its own copies. The copied DNA is…

Q: 9 The table opposite shows the standard riplet codes for the 20 amino acids involved in protein…

A: Transcription is the process in which the DNA strand which codes for a protein and e converted to…

Q: 2. Complete the leading strand and the complementary strand vith the 5'and 3' ends and identify he…

A: DNA replication is the process by which a new DNA molecule is formed and this process is known as…

Q: Translation is the flow of information from: a) DNAàDNA b) DNAà mRNA c) mRNAà polypeptide d)…

A: Introduction  Genome consists of DNA/RNA which consists of nucleotides either deoxyribose…

Q: 4. Which mRNA sequence complements the DNA sequence below? (LS1-1)

A: DNA is a polynucleotide strand. DNA is transcribed into RNA and RNA is translated into proteins.…

Q: I want to know how can I make RNA transcript through next dna sequencing. 5'ATGATCTTTAAAGGGCCC 3'

A: DNA or deoxyribonucleic acid is a polymer of deoxyribonucleotides connected together via…

Q: 5)Which type of nucleic acid would have the sequence "ACCGAUUG"? a)DNA b)mRNA c)Another type of…

A: Carbohydrates, amino acids, fats, and nucleic acids are the most important biomolecules found in…

Q: 2. What happens during translation? is read and Possible sentence frame: Translation is the process…

A: The protein synthesis occurs in cytoplasm by the process of translation.

Q: 5. There are huge amount of DNA in human that are not genetic sequence. Categorize them. The…

A: Minisatellites: They are repetitive sequences of DNA. Repeat length is 10-60 base pairs. Repeated…

Q: 2. What polypeptide will be created from the following strand of DNA? DNA A T. T A C A C MRNA AA

A:

Q: 13. What is the complimentary sequence of the following strand? CCCCTTAGGAACC? a. CCCCTTAGGAACC b.…

A: Nucleic acids are biopolymers formed of repeating units of monomers called nucleotides. There are…

Q: nscript: 3' TACAGTTAAGGCTCCACTGTTA 5' 5' 3' ino Acid Sequence (ex. Met-Trp- and so on) Second letter…

A: The genetic code is the relationship between the sequence of bases in DNA and the sequence of amino…

Q: 4. In the following figure, mark the position of the start codon, polyA, and the promotor. DNA ORF

A: The DNA sequence codes for the mRNA. DNA sequence consists of all the necessary requirements for the…

Q: 1. Write the complementary coding strand sequence 5' GGG ATG TCA CAC ATA TTT 2. Write the mRNA…

A: The coding strand of DNA is the one that contains the instructions for the gene in concern. The…

Q: 7. Fill in the following table. Acid TRNA MRNAI DNA DNA amino sense anti-sense UGA UGA, Histidine…

A: Transcription: It is the process through which the enzyme RNA Polymerase transfers information from…

Q: The three-nucleotide codon system can be arranged into ____________ combinations.a. 16b. 20c. 64d.…

A: Ribonucleic acid (RNA) is a nucleic acid found in both the nucleus and cytoplasm. Nucleotides are…

Q: 1. Calculate the size of the resulting fragments as they will occur after digestion and write the…

A: Hello. Since your question has multiple parts, we will solve the first question for you. If you want…

Q: 6. Two possible paint mutations are the substitution of lysine for leucine or the substitution of…

A: Every physiological characteristic or metabolism of our body mainly controlled by proteins. These…

Q: 1. Under each sequence of bases, write the sequence of bases complementary to each section of DNA in…

A: Introduction :  The primary nucleobases are cytosine (DNA and RNA), guanine (DNA and RNA), adenine…

Q: 8) Which of these describes the function of RNA polymerase? A. Amplifies the “message" by making…

A: Need to find which of the following is correct regarding RNA polymerase function.

Q: 9. Create a matching (complementary) DNA sequence for the following strand: A A A A A C CGA CCGATC

A: DNA is known to be the largest biomolecule in the cell. It is composed of two polynucleotide chains…

Q: 6. The DNA sequence of a portion of the TEMPLATE strand of a gene is 5'-CAATACGTAC-3'. A. Write the…

A: The Central Dogma theory, in Genetics, states that DNA makes DNA through Replication. DNA makes RNA…

Q: 11.Fill out the following table by adding the complementary RNA and DNA basses. NA NA А G C

A: Answer: Nucleic bases are the nitrogen containing compounds such as adenine , guanine , thymine ,…

Q: Hello, my question is in the picture below. Thank you in advance!

A: Transcription is the process of converting DNA into m-RNA in the presence of enzyme RNA polymerase.…

Q: 8. Which RNA molecule is NOT involved in the processes of transcription and translation? A.…

A: RNA or Ribonucleic acid is a type of nucleic acid. Transcription is the process of synthesis of…

Q: 1. The two sequences shown below are complementary to each other. T or F GTCGAC CAGCUG

A: Biological macromolecules are those that are made up of large molecules in order to carry out normal…

Q: 8. For the double strand DNA molecule below, assume the 3' DNA strand acts as the template for…

A: The process in which the DNA is converted into mRNA is called transcription and in which mRNA is…

Q: 9. Explain why DNA fragments move through a gel at different rates. (A2)

A: A technique called gel electrophoresis is used to separate DNA fragments (or other macromolecules,…

Q: 2a. The DNA is mutated on the 4th base pair to the following: DNA:3'TAC GAT GAG GTC TGA ACT 5' 5 ATG…

A: Mutations are changes in the base pair that can effect the way proteins and mRNA is formed it can…

Q: 4. Use the RNA strand below and list the appropriate amino acids. AUG AGU UAC CCG GGA

A: Introduction :- Organic molecules known as amino acids have side chains unique to each amino acid as…

Q: 11. Consider the sequence shown, determine the complementary RNA and the amino acids DNA TAC GTA TTT…

A: In this question, we are given sequence of DNA from which we have to determine RNA and protein…

Q: 9. What is the role ol RNA polymerase? To answer the question please: 1) name three types of RNA in…

A: RNA: It is made up of repeating strands of nucleotides which contain all the three parts (nitrogen…

Q: ATT  CGG  TCG  CGC  TTA  ACG

A: DNA stands for deoxyribonucleic acid which is the most prominent way of storing information among…

Q: 6. If you are given the DNA sequence: T-A-C-C-G-A-A-T determine the complementary RNA strand.

A: Introduction :- The term "DNA sequencing" refers to a common laboratory procedure for determining…

Q: 8. The CAS9 enzyme (shown in red in the image below arget and cut out specific DNA sequences.

A: As you have not mentioned which part to answer, we are answering first three for you. If you want…

Q: 6. If the first G changes to A what kind of mutation will happen? Show the change in amino acid…

A: Introduction :- A mutation occurs when the sequence of DNA changes. Mutations can occur as a result…

Q: Give me nucleotide sequence with pairing. Like this ATC TCA TGA GCC TAG AGT ACT. CGG

A: The nucleotides are the building blocks of nucleic acids. The nucleotides are formed of a…

Q: Translate a mRNA sequence into a protein sequence using the genetic code. 2) write the…

A:

Q: 7. Guanidinium group is associated with: a. Tyrosine b. Arginine c. Histidine d. Lysine e.…

A: Amino acids are building blocks of protein and amino acids are composed of an amino group, carboxyl…

Q: 8. Consider the following strand of mRNA. a. What would the original template DNA have been? b. What…

A: The central dogma of molecular biology is the metabolic process by which the DNA was converted into…

Q: 4. Which MRNA sequence complements the DNA sequence below? (LS1- 1) * A C SUP Sequence A O Sequence…

A: The DNA molecule in the cell stores the genetic information of the organism. But this information by…

Q: 4. Mark the following statements about the genetic code as TRUE or FALSE: The genetic code is…

A: Genetic code is a set of three nucleotides where one triplet is called as one codon.

Q: Write a DNA sequence that would encode the amino acid sequence…

A: In this question, we are given an amino acid sequence for which we have to determine DNA sequence.…

Q: 5. Create the complimentary strand for the DNA strand below. Make sure to label the parts and…

A: The base pairing rule of DNA is purine always pairs up with pyrimidine. Adenine(A) and Guanine(G)…

Q: 2) Create an mRNA strand based on the given DNA template strand: TACTT CCTATTITCT TGTCA CCGCACT TIT

A: Messenger RNA (mRNA) is a single-stranded RNA molecule that is complementary to one of the DNA…

Q: 1. The following is the DNA sequence of a gene: 3' TACTAACTTAGCCTCGCATC 5' a. What amino acids are…

A: Non sense codons are stop codons which lead to termination of translation. These are - UAA, UAG,…

Q: 9. Describe the effect on the protein chain if base pair #20 in the parent DNA chain is missing. 10.…

A: The majority of living organisms have DNA as their genetic material. The genetic information is…

Q: 8. Complete the following table. Remember to label the 3' and 5' ends of all polynucleotides. Assume…

A: