2 3 4 please I need to understand thanks 2. To make 100mL of 75mM NaCl, weigh ANSWER (include unit) of NaCl, place in agraduated cylinder, and add water to make the total volume ANSWER (include unit).3. To make a 400mL of 1.5% NaCl, weigh ANSWER (include unit) of NaCl, place in agraduated cylinder, then add water to make the total volume ANSWER (include unit)4. You have a 1.5 g/mL stock solution of protein.To make 200mL of 15 mg/mL solution, add ANSWER (include unit) of stock and ANSWER(include unit) of water for a final volume of ANSWER (include unit). (HINT: Convert units)NSWER DilAQ@2W# 3E$4ARB%5ITMacBook ProU^6Y&7U8

“Since you have posted multiple questions, we will provide the solution only to the first question…

Answered: 2. To make 100mL of 75mM NaCl, weigh…

2. To make 100mL of 75mM NaCl, weigh ANSWER (include unit) of NaCl, place in a graduated cylinder, and add water to make the total volume ANSWER (include unit).

Nutrition Through The Life Cycle

7th Edition

ISBN:9781337919333

Author:Brown, Judith E.

Publisher:Brown, Judith E.

Chapter4: Nutrition During Pregnancy

Section: Chapter Questions

Problem 23RQ

See similar textbooks

Related questions

Q: 10. Which type of placentation is found in dogs and cats? O A. Discoid O B. Diffuse O C.…

A: Introduction The term "placentation" describes the development and structure of the placenta, an…

Q: Each _____________ consists of _____________ sister chromatids that are _____________ . Question…

A: A bivalent is a pair of homologous chromosomes that come together during meiosis. Each bivalent…

Q: In what way are the structures of mitochondria and chloroplasts similar and different? What…

A: Introduction: ll organelles are specialized structures within eukaryotic cells that have specific…

Q: Hookworms, parasitic nematodes transmitted through contact between bare feet and soil, infect nearly…

A: 3 a) As the hookworm is nematode parasite , to find the FST between these two given population that…

Q: What is meant by the term "Critical concentration" with respect to actin filaments?

A: The microfilament or actin filament is made up of monomeric globular actin protein or G-actin. Actin…

Q: What would be the correct response of the myogenic mechanism to regulate glomerular filtration rate…

A: Maintaining a proper glomerular filtration rate (GFR) is necessary because it ensures the nephrons…

Q: What disease does this organism cause

A: The above image if of Entamoeba genus.It is a single cell organism with a distinct nucleus. We have…

Q: Case study 1 Melanoma A 50-year-old woman presented one year ago with a skin lesion, a biopsy was…

A: Cancer is a complicated illness caused by a variety of hereditary and environmental variables. The…

Q: Do you think some ingrediants in foods, that prolong the life of that food, make it easier or harder…

A: Preservatives: Preservatives are substances added to food and other products to prevent spoilage,…

Q: When organisms acquire energy from the food web where in their cells do they store this energy?

A: A food web is a complicated network of linked food chains that shows how nutrients and energy move…

Q: A Na+ 10 msec B 40mV Ca²+ C Na+ Ca²+ Each graph represents the depolarization activity during an…

A: Introduction: An action potential is a brief electrical signal that travels along the membrane of a…

Q: What type of fiber binds with cholesterol to prevent absorption, reducing blood cholesterol levels?…

A: Introduction: Fiber is a type of carbohydrate that cannot be digested by the body. Instead, it…

Q: Write a Worm neuronal function assay paragraph about a worm neuronal function and find an experiment…

A: A worm neuronal function assay is a type of experimental test used to investigate the function of…

Q: When it comes to healthcare, why should people even bother with using the internet? How does remote…

A: Health Care: Health care refers to the maintenance and improvement of an individual's physical,…

Q: What preventive and control measures can you give against intestinal protozoan diseases

A: Single celled organisms that can infect the digestive system cause intestinal protozoan diseases.…

Q: Justinian’s Plague was the first appearance of Pasteurella pestis in Europe (6th century AD). Who…

A: Plague is a highly infectious and often deadly disease caused by the bacterium Yersinia pestis. The…

Q: Select from the following adaptations for reproduction that occurred during protostome…

A: Introduction Mollusks, annelids, and arthropods are all included in the diverse group of animals…

Q: What legend would you give to the labeled model data?

A: This question is about a laboratory experiment involving gel electrophoresis of plasmids. The…

Q: Which brain nucleus is larger in female rats compared to male rats? a) Anteroventral periventricular…

A: SDN-POA, is typically larger in male rats than in female rats. SNB is a region in the midbrain that…

Q: Which of the following excretory organs does not employ ultrafiltration? A. The Malpighian tubules…

A: Introduction: Under high pressure, a semipermeable membrane is used to filter blood or other bodily…

Q: Did the authors discover any microbes present that should be cause for concern, in your opinion (and…

A: Gouda cheese is a popular semi-hard cheese that originated in the Netherlands. It is typically made…

Q: An in-class test of the opponent process theory of color vision relied on a basic principle of…

A: Color vision theory is a scientific explanation for how the human eye and brain perceive and process…

Q: Please help me with these questions based on the graph attached. More than one answer may be correct…

A: People who are suffering from diabetes and are not under any medical treatment of any doctors. Their…

Q: What are the nursing responsibilities pre procedure in CT scan?

A: As a nursing professional, the following are some of the key responsibilities that you should…

Q: So the correct answer is hydrogen bonds?

A: Protein structure is fundamental to understanding the function of proteins in biological systems.…

Q: Correlate transport maxima and gradient-time limited transport in proximal tubule.

A: In the kidney, the proximal tubule is the first segment of the renal tubule. It is in charge of…

Q: On the rapidity of antibiotic resistance evolution facilitated by a concentration gradient" Full…

A: A increasing threat to public health is posed by the introduction of bacterial strains quickly that…

Q: 5' AGGCC TAAGTTCCCTCACACACACAGGG 3' 3¹ TCCGGATTCAAGGGAGTGTGTGTGTGCCC 5' B a mutation in an exon can…

A: Genes are hereditary structures on genetic material. These control some specific particular traits.…

Q: Which of the following is a good description of Sympatric speciation? A. Speciation without…

A: The process of speciation that occurs within a single, continuous population without the presence of…

Q: B. OSMOTIC PRESSURE Record the following results, indicating the relative amount of growth at each…

A: Effect of NaCl concentration on Microbial growth: Non-halophilic bacteria: Non-halophilic…

Q: Chapter 6 Body Composition The following are the videos you will need to watch for Chapter 6.…

A: Body composition refers to the proportion of fat, muscle, bone, and other tissues that make up a…

Q: Which of the following best describes the relationship between fig trees (Ficus carica), the…

A: Species interactions are the relationships that exist between different species in an ecosystem.…

Q: Eye reflexes Pupillary Light Reflex Pupillary Dark Reflex Ciliospinal Reflex Lens Accommodation…

A: An eye reflex is an automatic or involuntary response of the eye to a stimulus. These reflexes are…

Q: I need help answering this queshtion based on the answer in the article you are whitin a…

A: Microbiota: Microbiota refers to the collection of microorganisms that live in and on the human…

Q: The KEGG pathways (ribosome biogenesis and protein processing) indicate that the attachment of…

A: Glycosylation is the attachment of carbohydrates to proteins and is a common post-translational…

Q: Pre-lab questions (due at the start of the lab period on a separate sheet of paper 1. What is a…

A: 1.coelom The majority of vertebrates, some invertebrates like annelids, and a few phyla of…

Q: Which of the following factors does not directly affect cardiac output? the volume of blood ejected…

A: Cardiac Output: Cardiac output (CO) is the amount of blood that the heart pumps out per minute. It…

Q: Some types of antibiotics can permanently destroy hair cells near the base of the cochlea, close to…

A: Introduction Hearing loss is a partial or total inability to hear sounds in one or both ears. It…

Q: How are the light-capturing and Calvin cycle parts of photosynthesis coupled? How would poisoning…

A: Plants and some microbes employ the process of photosynthesis to transform light energy into…

Q: Blue eyes and a straight hairline are both recessive alleles for two different genes. The dominant…

A: This is a dihybrid cross concerned with two characters at a time. Let the genotype for brown eyes be…

Q: You are given the biochemical pathway below. Seven mutant strains (labeled S1-S7) are defective in…

A: The answer of this question will be option c, None of these.

Q: 1) During anaphase, Kinesin-13 proteins are localized at the kinetochore (A1) and the spindle pole…

A: Microtubules are thin, cylindrical structures composed of tubulin protein subunits. They are…

Q: Epinephrine B-Adrenergic /receptor В G-Protein function Adenylate cyclase GTP ATP Protein kinase A…

A: Cell signal involves communication between cells with the help of specific signaling molecules that…

Q: What are the products of photosystems II and I in noncyclic electron flow? Draw a Z-scheme shows the…

A: In the light-dependent processes, there are two different types of photosystems: photosystem II and…

Q: Caffeine and nicotine have excitatory effects because they: reduce the threshold for…

A: Caffeine and nicotine are both central nervous system stimulants. Caffeine can be found in coffee,…

Q: What is the purpose of using an outgroup when reconstructing a phylogenetic tree? [at least mention…

A: Introduction A phylogenetic tree is a diagram that represents the evolutionary relationships among…

Q: Red-green color blindness means that a person cannot distinguish shades of red and green (usually…

A: Introduction : Colour blindness is an X - linked recessive disease. So if one X chromosome is…

Q: Case study: JR 19-year-old suffers a head injury after a MVA and is being transported to the ER.…

A: Introduction The nervous system is a complex network of specialized cells called neurons, which…

Q: Describes the relationship of the following terms using short terms: IL-2 receptor Lymph Node…

A: Lymphocytes are the one among the white blood cells of immune response. They help in fight against…

Q: Amikacin Antimicrobials Amoxicillin/clavulanate Ampicillin Cefazolin Cefepime Ceftriaxone…

A: Excessive Zn++ in the medium can have various effects on different groups of living organisms.…

Question

2 3 4 please I need to understand thanks

2. To make 100mL of 75mM NaCl, weigh ANSWER (include unit) of NaCl, place in a
graduated cylinder, and add water to make the total volume ANSWER (include unit).
3. To make a 400mL of 1.5% NaCl, weigh ANSWER (include unit) of NaCl, place in a
graduated cylinder, then add water to make the total volume ANSWER (include unit)
4. You have a 1.5 g/mL stock solution of protein.
To make 200mL of 15 mg/mL solution, add ANSWER (include unit) of stock and ANSWER
(include unit) of water for a final volume of ANSWER (include unit). (HINT: Convert units)
NSWER DilA
Q
@
2
W
# 3
E
$
4
A
R
B
%
5
I
T
MacBook Pro
U
^
6
Y
&
7
U
8

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

12. Metabolic acidosis caused by fixed acids is present when the anion gap is greater than A. 9 mEq/L B. 14 mEq/L C. 20 mEq/L D. 25 mEq/L
At a pH of 7.40, the carbonic acid ratio is ________. a. 35:1 b. 4:1 c. 20:1 d. 3:1
A physician has ordered 5 gr of a medication. It is available in solution form as 20 gr per fl oz. How many fl oz should you give? How many cc would you give? How many minims would this be?
You have a 6 M solution of stock A. You do the following serial dilutions: Add 1 ml of stock A to tube B. Add 9 ml H2O. Mix.Then take 1 ml from tube B and put it into tube C. Add 19 ml H2O. Mix. Then put 5 ml from tube C into tube D. Add 5 ml H2O. A. what is the final (cumulative) dilution of stock A (dilution factor)? B. What is the final concentration (include units) after all these dilutions?
Calculate the amount of BSA you will add to the tube to get the concentrations listed on the chart. Your stock tube is 2mg/mL. The amount of water will be the amount to bring your total volume up to 100uL. Standard Concentration BSA H2O Total volume A 200 ug/mL 100uL B 150 ug/mL 100uL C 100 ug/mL 100uL D 50 ug/mL 100uL E 20 ug/mL 100uL F 10 ug/mL 100uL G 5 ug/mL 100uL H 0 ug/mL 0 uL 100uL 100uL
1. The standard curve was prepared using BSA as a standard with a concentration of (2.0 mg/ml, 1ml). Fill in the table below and show the calculations for determining the final BSA concentration in each vial. Formula C1V1=C2V2
Appropriate pippetor for measuring 10ul of liquid is: 200 1000 20
1. The prescription for an oral solution reads “1 tbsp ac & hs x 10d.” What is the minimum (in mL) of solution should you dispense? 2. A nursing floor requires half liter of 50% isopropyl alcohol. How many mL of 70% isopropyl alcohol will be needed for compounding this order? 3. How may grams of pure dextrose is needed to prepare 100cc of D50W?
How many mL of 19 mM SDS would you need to make 76 mL of 2 mM SDS? Report your answer rounded to 1 decimal place.
11. ● Possible methods for the quantitative determination of sodium bicarbonate for injection are: A) Acidimetry B) Alkalimetry C) Complexometry D) Iodometry E) Refractometry ● Calcium chloride is available in dosage forms: A) Powder for preparation of injections B) Solution for injection 10% in ampoules C) Tablets of 0.3 g D) Solution for injection 25% in ampoules E) Dry dosed powder
You are asked by the pharmacist to add 45 mEq of Ca Gluconate in an IV bag of D5W 1000mL. You have a concentrated vial of Ca Gluconate 4.4 mEq/mL, 50 mL. How many mL of this concentrated vial needs to be added to the IV bag?
1.If a standard dose of your medication is 28mg/kg how much of your medication ingrams, would you give if your patient weighed 177 Ibs? 2.If one tablet contain 1125 mg and the patient consumed 4 tablets did they overdose orunder-dose and by what factor (how much?