I. Effect of pH on ezyme activity pH Test tube Observation I 2 4 4 5 12 Conclusion: 8. 3.
Q: What part of the electron transport chain is responsible for the greatest contribution to oxidative…
A: Protein complexes are present in the inner membrane of mitochondria forming an electron transport…
Q: Which of the following best describes an amino acid that can be used to synthesize proteins?
A: Monoprotic acids - are the acids that donates only one proton (H atom) per molecule of acid to an…
Q: Analysis of a octapeptide revealed the presence of the following products: 2 Arg, 1 Gly, 1 Met, 1…
A: Edman Degradation – This is method of peptide sequencing. In this method amino terminal residue is…
Q: Which of the following statements concerning the enzyme regulation is CORRECT? Select one: A.…
A: Allosteric enzymes have two different binding sites. One is the active site and the other one is the…
Q: Calculate the values of the
A: Enzyme kinetics is a study of the rate of enzyme catalyzed reactions. In Michaelis-Menten kinetics,…
Q: explain serotonin dopamine and gaba and its effects.
A: Serotonin, dopamine and gaba all are the neurotransmitters means all are chemical massengers of…
Q: 29. Here is a strand of DNA: TACCCGGTATAACGCTGGAAAGCTTAAGCAACATCGCCCGACCCC AAATCT…
A: DNA strand given here with directionality is as: 5’…
Q: 1.The 22nd amino acids and the only amino acid * A. Selenocysteine B. Selenicysteine C.…
A: Since you have asked multiple questions, we will solve only first question for you. If you want any…
Q: does HEW have a higher concentration of negatively/neutral charged protein (at ph 7) explain ur…
A: HEW ( hen egg white) is an enzyme specifically known for its ability to degrade the polysaccharide…
Q: Which of the following contain statements that are both correct? Aspartame triggers the…
A: Aspartame is an artificial sweetener. It first binds and activate a GPCR. The G-alpha bound to GTP ,…
Q: Iculate the actual, physiological deltaG for the reaction Phosphocreatine + ADP > creatine + ATP at…
A: Disclaimer: Since you have asked multiple question, we will solve the first question for you. If you…
Q: 1) What is the chemical group at the end of the R groups of basic amino acids that makes them…
A: There are twenty standard amino acids that make up all of the proteins. The twenty standard amino…
Q: A biochemist wants to determine the effect of an inhibitor on a certain enzyme. The data are shown…
A: The rate of enzyme catalyzed reactions is directly proportional to the substrate concentration. But,…
Q: Which of the following samples are expected to cause a decrease in absorbance over time when…
A: Ensuring adequate light reaching a detector by using water colloidal solutions in light or X-ray…
Q: What is the flow of genetic information?
A: The flow of genetic information is always unidirectional. It is depicted in central dogma…
Q: Describe the ion dynamics of the muscle-contraction process.
A: Tension-generating regions within muscle cells are activated during muscular contraction. Muscular…
Q: Lys and Arg Glu and Lys Pro and Asp Among these amino acid combinations listed above, only the…
A: Proteins are composed of a linear chain of amino acids attached together via peptide bonds. All…
Q: Which of the following is INCORRECTLY paired? O Isoelectric focusing : Charge O Gel filtration…
A: 1. Isoelectric focusing IEF is an electrophoretic method for separating proteins based on their…
Q: what is the chemistry of nucleosides?
A: Nucleosides are nothing but glycosamines whose analogues are used as anti cancer agents or antiviral…
Q: Enzymes increase the rate of a chemical reaction by providing an alternative path with a lower…
A: TRUE
Q: king of acid
A: Acid is the substance which turns blue litmus to red. Acid contains more H+ ions. Acids acts as…
Q: Figure 1. Enzyme and potential substrates
A: Enzymes are usually composed of proteins and it catalyzes biochemical reactions in our body. It is…
Q: Failed to follow
A: Waxes are a broad category of organic compounds that are lipophilic and bendable solids at room…
Q: -Inhibitor +Inhibitor [S] (mM) V0&νβσπ; (μmol/sec). V0&νβσπ:&νβ σπ: (μmollsec) 0.0001 33 17 0.0005…
A: Km of an enzyme is the substrate concentration at half Vmax. It can be calculated from lb plot by…
Q: 1. What is the physiologic function of pigments in plants?
A: Pigments are compounds that absorb specific wavelengths and reflect away, the other. Plant parts are…
Q: Aldosterone is glucocorticoid hormone with Na+/K+ balance i the human body. Cortisol is an…
A: The hormones in the body play a central role in maintaining key homeostatic processes in the body.
Q: A polypeptide with a net positive charge at physiologic pH (~7.4) most likely contains amino acids…
A: The pKa values of the side chains of amino acids determine the net charge on a protein at a…
Q: Biochemistry Question: Nonenzymatic glycosylation or glycation creates glycoproteins by
A: Glycoproteins are molecules that comprise protein and carbohydrate chains that are involved in many…
Q: Which of the following condition is NOT associated with riboflavin deficiency? * (Please choose one…
A: Riboflavin is a water soluble vitamin. It is also called as B2 vitamin. Foods like pork, eggs,…
Q: How many activation cycles, Initiation cycles, Elongation cycles and termination cycles are needed…
A: Protein synthesis occurs in four main steps such as activation or charging of tRNA, initiation of…
Q: In sample preparation for electron microscopy, arrange the following steps in correct order A. Apply…
A: Electron microscopy is the technique of visualising the structure of tissues, cells and organelles…
Q: Which of the polysaccharides WILL DECREASE GELLING if acid is added to the sample? pectins…
A: Gels are solid, jelly-like structures made of colloid polysaccharides, proteins, and polymers…
Q: In a paragraph format How amylase is used/its purpose and why amylase useful in the food industry
A: Any enzyme that catalyses the hydrolysis (breaking of a substance by the addition of a water…
Q: The fact that some eukaryotic rRNAs are self-splicing indicates that (A RNA can contain modified…
A: When transcription of DNA to RNA happens the introns are removed either by the RNA itself or by a…
Q: Which statement(s) correctly describe(s) protein structures? A. All hydrophobic residues are buried…
A: Proteins are made up of amino acids, which are the building blocks. Around 20 different amino acids…
Q: 6. DNA electrophoresis uses polyacrylamide gel for separation. a) True b) False 7. Agarose is a…
A: DNA is composed of nucleotides attached via phosphodiester bonds. DNA act as genetic material in…
Q: In the 1step of the 2-step reaction shown below, which substrate/co-substrate is being oxidized?…
A: The above reaction is a part of beta oxidation of fatty acid process.
Q: Which of the following is an incorrect grouping of amino acids based on their properties of the side…
A: Introduction: Amino acid is a compound that contains an amino and a carboxyl group and a side-chain…
Q: III. True or False a. Large proteins travel/migrate faster in both gel filtration chromatography…
A: Different techniques used in the separation and purification of the biomolecules are, Chromatography…
Q: The enzyme is considered to be alan * COO Lactate COO dehydrogenase HO-C-H + NAD 0 + N
A: LDH, or lactic acid dehydrogenase, is an enzyme that is a type of protein. LDH is critical in the…
Q: Briefly describe four ways in which a protein could be denatured.
A: The highly organized structures of proteins are true works of chemical architecture. Denaturation…
Q: Derive the amino acid sequence that is coded for by each of the following mRNA sequence. 5' CAA…
A: Amino acid are molecules which are combine to form a protein molecules.Amino acid are synthesized by…
Q: Suppose you want to determine if excessive lipid ingestion altersgene transcription. Describe and…
A: Dietary fat is a crucial macronutrient for the increase and development of all organisms. In…
Q: Bradford technique
A: The Bradford assay is based on the use of the dye Coomassie Brilliant Blue G-250, sometimes known as…
Q: Describe in detail synaptic termination by enxymes and by reuptake
A: Introduction: Neurotransmitters are chemical messengers that transfer signals from a neuron to a…
Q: 1. What is the effect of increasing the concentration of lactose in the action of the enzyme…
A: "Since you have posted multiple question, we will answer the first question for you. If you want any…
Q: For beta-oxidation of an 18:1 oleate mono-unsaturated fatty acid: - How many Acetyl CoA produced? -…
A: Fatty acids are molecules with hydrocarbon chain and carboxylic acid group. In the absence of…
Q: GIVEN: Centrifuge A: rotor radius - 5 cm; max. speed - 4,000 xg Centrifuge B: rotor radius -7 cm;…
A: Centrifugation is a process that uses centrifugal force to separate mixtures. A centrifuge is a…
Q: Using G-25 Sephadex beads (Fractionation range 1000-5000) KD, a sample of Vitamin B12 (MW ~1500 KD)…
A: Note : Hi ! Thank you for the question. We are authorized to answer one question at a time. Since…
Q: Explain under what conditions "substrate concentration" is the limiting factor for enzymatic…
A: Enzyme and substrate bind each other form E-S complex which decomposes to give product. Substrate…
You can use this as your references: https://www.youtube.com/watch?v=34VkaCJggOM
Step by step
Solved in 2 steps with 2 images
- Treatment with NAD for hangovers: possible? Explain?Prednisone 5mg Quantity: CLXIV 5 tabs po qd x4 d, taper down by one tablet every 5 d for 15 d then ss po qd. how many tablets should be dispensed?Pathology results of a DKA diagnosed patient are as follows: Glucose 28 mmol/L Potassium 5.8 mEq/L Explain the above values and describe the pathophysiology associated with these results.
- The level of ketones should be low or absent in MCAD patients?Patient M., 57 y/o, complains of nausea, vomiting and muscle ache. Objectively: evident symptoms of dehydration, Kussmaul’s respiration, arterial pressure - 90/50 mm column of mercury, anuria, temperature – 35.9 ºC, glycemia – 12.9 mmol/l, no acetonuria, blood PH – 6.8, lactic acid content -1.7mmol/l (norm - 0.62 -1.3 mmol/l). Hyperlactacidemic coma has been diagnosed. What therapeutic measures should be taken first of all? Injecting 8.5% solution of sodium bicarbonate, and 1% solution of methylene blue Injecting 20-25 units of short-acting insulin intravenously by stream infusion Injecting 40-60 units of short-acting insulin subcutaneously Injecting 50-100 ml 40% glucose solution Injecting 400 -500 ml 5% glucose solutionpathophysiology Diagnostic measurement of protein metabolism is measured the plasma levels of ________________. give scientific rational A.ammonia B.urea C.creatinine D.nitrogen