1) If a mutation caused an alanine to turn in glycine, what kind of effect do you think that would have on the protein structure? Explain your reasoning. 2) If a mutation caused an alanine to turn into a glutamine, what effect do you think that would have on a protein? Explain your reasoning.
Q: 2. Calculate the overall charge (pH 7) on the following three polypeptides and answer the questions ...
A: Hi! Thank you for the question. We are authorized to answer three subparts at a time, since you have...
Q: Biochemistry Question: Give one example of 5-Carben Sugar
A: Introduction: A five-carbon sugar found in the DNA is deoxyribose. It forms the central molecule in ...
Q: A biochemist wants to determine the effect of an inhibitor on a certain enzyme. The data are shown b...
A: To determine the values of km and Vmax by lineae regression, we need to plot lb plot. LB plot can be...
Q: Practice 26: Consider the following portion of mRNA: 3'-CUU-AAA-CGA-GUU-5' What is the primary amino...
A: Transcription is the process of synthesis of mRNA from DNA. During the translation process, the mRNA...
Q: What would happen to the functionality of cholic acid if the 3 hydroxy groups were removed? A) Ther...
A: Fats are water insoluble amphipathic molecules. More than 90% of the structure of a fat is hydrophob...
Q: The molecule shown below is NH2 HO N. Но но
A: Deoxyribonucleic acid (DNA) is a molecule comprised of two polynucleotide chains that wrap around ea...
Q: It is known that 80% of Penicillin is protein bound. Explain how most of it is being cleared from th...
A: Penicillin is an antibiotic and a beta lactam drug. Penicillin upon administration into humans , go ...
Q: 1. A sigmoidal plot of substrate concentration ([S]) verses reaction velocity (V) may indicate: (A) ...
A: Hi. Thank you for the question. As per the honor code, We are allowed to answer three sub-parts at a...
Q: 8. Why are histamine and serotonin contents increased in the site ol inila latory?
A: Histamine is an organic nitrogenous compound which is synthesized from amino acid residue L-Histidin...
Q: Which of the following is the correct order of events in mitosis? 1. Sister chromatids line up a...
A: In mitotic cell division the phase is the period in which the duplicated chromosomes are divided eq...
Q: Which of the following is TRUE? Select one: a. The disulfide bridges formed by oxidation of the sulf...
A: The tertiary structure of the proteins is due to various interactions between the side chains in the...
Q: Which of the following samples are expected to cause a decrease in absorbance over time when perform...
A: Ensuring adequate light reaching a detector by using water colloidal solutions in light or X-ray be...
Q: -Inhibitor +Inhibitor [S] (mM) Vη&νβσπ:(μmol/sec). V0&νβσπ&ν βσπ (μmol/sec) 0.0001 33 17 0.0005 71 5...
A: Km is the michaelis menton constant which is a substrate concentration at half Vmax. This can be obt...
Q: GIVEN: Centrifuge A: rotor radius - 5 cm; max. speed - 4,000 xg Centrifuge B: rotor radius - 7 cm; m...
A: Centrifuge is a device used for separating molecules having different densities. The process is call...
Q: Match the outcomes on the left with the laboratory steps on the right. ___ Harvest the cells ...
A: Introduction: DNA isolation is a process of purification of DNA from samples using a combination of ...
Q: Explain the role of CDK inhibitors. If cyclin-CDK complexes are necessary to allow regulated progres...
A: Cyclin-structured kinases (CDKs) were considered promising drug targets for some years, however, max...
Q: Given the following reaction, identify the class and subclass of the enzyme involved. CH,OPO,2- он Ç...
A: Enzymes are the chemical substances that catalyse reactions by decreasing their activation energy. T...
Q: Choosing the proper buffer solution In Protein Precipitation, two liters of 5mM buffer solution wit...
A: The processes that occur in the body require a specific and stable pH range. Buffers are solutions t...
Q: Evaluate the line depicted by line B, presence of. ... A B C Substrate concentration competitive inh...
A: The plot of velocity and substrate concentration of an enzyme-catalyzed reaction gives a hyperbolic ...
Q: Consider the following portion of mRNA: 3'-CUU-AAA-CGA-GUU-5' What is the primary amino acid structu...
A: mRNA(messenger RNA) carries the genetic information copied from DNA in the form of a series of tripl...
Q: Consider a protein with a beta conformation sequence EAGQVHRGP a) Which residue(s) can be substitute...
A: Beta conformation in protein: Beta sheet, beta-turn etc are beta conformation in protein. Beta sheet...
Q: Enzymes increase the rate of a chemical reaction by providing an alternative path with a lower activ...
A: TRUE
Q: 6. DNA electrophoresis uses polyacrylamide gel for separation. a) True b) False 7. Agarose is a natu...
A: DNA is composed of nucleotides attached via phosphodiester bonds. DNA act as genetic material in mos...
Q: If you have to prepare 4 nM solution of human IgG ( immunoglobuline) which has molecular mass of 150...
A: The number of moles of a solute present in one liter of the solution is called the molarity of that ...
Q: Assessing the efficacy of glucosamine and chondroitin sulfate for arthritis pain Treatment with...
A: Many patients with arthritis, particularly osteoarthritis, utilise vitamins in their diet to relieve...
Q: Which of the following is an incorrect grouping of amino acids based on their properties of the side...
A: Introduction: Amino acid is a compound that contains an amino and a carboxyl group and a side-chain ...
Q: Drug A has an half-live of 6 hours, a volume of distribution of 40 liters, and a bioavailability fra...
A: Total body clearance is defined as the volume of blood from which all drugs are removed per minute a...
Q: why is there glucose 6-phospI n the ER lumen A. Glycogenolysis occurs in the ER lumen. B. It prevent...
A: Introduction: Glycogenolysis is the catabolism of glycogen to form glucose. The glycogen branches ar...
Q: 29. Here is a strand of DNA: TACCCGGTATAACGCTGGAAAGCTTAAGCAACATCGCCCGACCCC AAATCT ATGGGCCATATTGCGACC...
A: DNA strand given here with directionality is as: 5’ TACCCGGTATAACGCTGGAAAGCTTAAGCAACATCGCCCGACCCCAAA...
Q: Show the relationship between lipids, nucleic acids, proteins, and carbohydrates including the conne...
A: A biomolecule, also called a biological molecule, is a chemical compound found in living organisms. ...
Q: List down the 25 different antibiotics and give the mechanism of action
A: Antibiotics, also known as antibacterials, are medications that either kill or slow the growth of ba...
Q: III. True or False a. Large proteins travel/migrate faster in both gel filtration chromatography a...
A: Different techniques used in the separation and purification of the biomolecules are, Chromatography...
Q: Aldosterone is glucocorticoid hormone with Na+/K+ balance i the human body. Cortisol is an adrenocor...
A: The hormones in the body play a central role in maintaining key homeostatic processes in the body.
Q: Compare and contrast antibiotic and antiviral treatments. Analyze how different antiviral therapies ...
A: Antibiotics are the group of antimicrobial substances which are used to inhibit or to destroy any mi...
Q: You'lre hungoy, body Cmuttiple g the following e optim posei ble) which Occur in Our toonelete (A) À...
A: Hungryness is a feeling that stimulates food intake. There are number of pathways that stimulate goo...
Q: Most of the ultraviolet absorption of proteins at 280 nm is due to their content of O Tryptophan O A...
A: Proteins in solution absorb UV light at 280 and 200 nm, exhibiting absorbance maxima at these wavele...
Q: Calculate the actual free energy of hydrolysis of ATP, delta Gp in the erythrocytes of a new species...
A: Actual free energy (∆G) is the maximum amount of energy which is available to perform work. Standard...
Q: What are the different mechanism of disease production?
A: The disease production mechanism identifies the likely source or causes of a problem/disorder, as we...
Q: A biochemist wants to determine the effect of an inhibitor on a certain enzyme. The data are shown b...
A: The rate of enzyme catalyzed reactions is directly proportional to the substrate concentration. But,...
Q: Colchicine is used to treat gout. It alters cytoskeleton function. Why do you think it is useful for...
A: Gout is a frequent and complicated form of arthritis that can strike anyone at any time. It's charac...
Q: Dopamine, norepinephrine and epinephrine are collectively called catecholamines. Which of the follow...
A: Catecholamines are group of hormones made by adrenal glands and its is secreted the chromaffin cells...
Q: Which of the following is/are incorrect? - All proteins are polymeric - Not all nucleic acids are...
A: A biomolecule, also called a biological molecule, is a chemical compound found in living organisms. ...
Q: In sample preparation for electron microscopy, arrange the following steps in correct order A. Apply...
A: Electron microscopy is the technique of visualising the structure of tissues, cells and organelles a...
Q: estion properly and accordingl
A: The saponification value of oil is measured by the number of milligrams of potassium hydroxide (KOH)...
Q: Give 5 examples of molybdenum complexes. State their physical and chemical properties and their impo...
A: The atomic number of molybdenum is 42 and it is represented by the symbol 'Mo'. On the earth,...
Q: discuss any complications of acidity or alkalinity of foods on another organ or system in the body? ...
A: pH is the measure of the strength of H+ ion or Hydronium ions in solution. pOH is the measure...
Q: (Part A) Coenzyme-dependent enzymes can catalyze the general transformations shown below. What would...
A: The process of translation takes place in the cytoplasm which converts mRNA to protein/en...
Q: Give one example of 5-Carben Sugar
A: A sugar is a polyalcohol that has had at least one of its constituent alcohols oxidized to an aldehy...
Q: What assay could be used to test the function of a protein in the glycoside hydrolase family?
A: Glycoside hydrolases are enzymes that catalyze the hydrolysis of the glycosidic linkage of glycoside...
Q: 1. Which of the following molecule can act as molecular chaperons for assisting the folding of prote...
A: A broad set of unrelated protein families whose function is to stabilise unfolded proteins, unfold t...
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Below is the structure of glycine. Draw a tripeptide composed exclusively of glycine. Label the N-terminus and C-terminus. Draw a box around the peptide bonds.a. which amino acid can form a covalent bond with its side chain? b. which amino acid can contribute to protein tertiary and quarternary structure by forming a covalent bond?Can a mutation change a protein’s tertiary structure without changing its primary structure? Explain your answer.
- If a Cys residue in a protein was replaced with either Ser or Phe amino acid, which substitution would you expect to result in the greatest structural change and why?Refer to the figure below. Replacing lysine with another amino acid in the protein may alter the shape and function of the protein. Replacing lysine with which type(s) of amino acid(s) would lead to the least amount of change in the tertiary structure of this protein? Explain your answer.A portion of a polypeptide chain contains the following sequence of amino acids: (-Met, -Leu, -Ala, -Cys, -Asp-) a.) Which amino acid can form a disulfide bond? b.) Which amino acids are likely to make the polypeptide more soluble in water? c.) Which amino acids are likely to make the polypeptide less soluble in water? d.) How does the primary structure of a protein affect its tertiary structure?
- Name another condition besides heat and exposure to a bond disruptor (like alcohol) that could affect the ability of a protein to maintain its shape. Explain.Refer to the figure below. Replacing lysine with another amino acid in the protein may alter the shape and function of the protein. Replacing lysine with which type(s) of amino acid(s) would lead to the least amount of change in the tertiary structure of this protein? Explain.What could be the implications if there is a misfolding in the protein structure?
- if glutamic acid were replaced by proline in a protein, how would the tertiary structure be affected?why would one missing amino acid make a difference in the protein's shape, and why would a change in shape be so important to the functioning of the protein?Which of the following amino acids is most likely to be found on the outside of a soluble protein, and which of them is more likely to be found on the inside? Explain each answer. (Hint: Consider the effect of the amino acidside chain in each case and that the protein is folded up into its globular form.)(a) Valine (b) Aspartate(c) Histidine (d) Alanine