First LetterAGUс22. Using the provided "Genetic Code-Reference" answer the following question.Based on the following DNA template strand, write out the amino acid chain produced.23. Consider the following mRNA base codon sequence 5'-AUC-GAA-3' and the provided "GeneticCode-Reference".Genetic Code-ReferenceUUUUUCUUAUUGCUUCUCCUACUG(mutated or silent)(mutated or silent)b. Briefly explain your reasoning for each. (be sure to include both parts)AULLYAUUa. Label which of the following would result in a mutated amino acid sequence or a silentmutation. (May help to first determine the original amino acid sequence, then compareto mutations)UPhemRNA codon sequence:anticodon sequence:amino acid sequence:LeuLeu5'-AUA-GAA-3'Val5'- AUC-GAC-3'AUC IlleAUAAUAJ*AUG Met/StartGUUGUCGUAGUGUCUUCCUCAUCG)CCU)CCCcccCCA000CCGACUACUACCACAACG,CGCUGCCGCAGCGSecond LetterSerProThr3'-CAA-GTC-TGT-5'AlaUAUUAC) TyrТугA**UAA StopUAG StopCAU]CACJCAACAG/GinGAUGACGAAGAGAAU AstAAC)AAA]AAG/Lys>HisAspGluGUGUUGC Cys**UGA StopUGG TrpCGUCGCCGACGGArgAGUAGCAGA]AGG ArgGGUGGCGGAGGGSerGlyThird LetterUс сAGUсAAG11UCAGUCAG

Transcription is the process of formation of RNA from a DNA. The RNA chain is synthesized in the…

Answered: 22. Using the provided "Genetic…

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter29: Transcription And The Regulation Of Gene Expression

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

A fragment of bacterial DNA reads: 3’ -TACCTATAATCTCAATTGATAGAAGCACTCTAC- 5’ Assuming that this fragment is the template strand, what is the sequence of mRNA that would he transcribed? (Hint: Be sure to identify the initiation site.)
Remember when looking up a codon make sure it is in its mRNA form. Below is a sample of a segment of DNA…(copy from left to right) 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ What would be the problem if ATT was inserted into the DNA template strand after the second codon? (Be sure to consult the coding chart for amino acids). 2.What if the second amino acid was repeated over 5Ox. What amino acid is repeated? What type of mutation is this? If this is on chromosome 4, what genetic disorder is this? Often this type of mutation does show symptoms until middle age. What problem does this create? 3.What are three differences between a point mutation and deletion mutation
a. Replicate this sense strand to create a double-stranded DNA helix. Write your answers in CAPS LOCK with NO SPACES between the nucleotides - e.g. ATGCCGAG..... TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT complementary strand: b. Using this DNA double helix, express the gene – i.e. determine the resulting polypeptide sequence by using the correct reading frame. Write your answers using the three letter abbreviation for each amino acid. polypeptide sequence: does the sense strand DNA sequence have 5’ and 3’ UTR sequences? 5'UTR = 3'UTR =
Convert the DNA template to mRNA. Then,convert the mRNA to tRNA. Based from theresulting sequence in the anticodons of tRNA,determine the appropriate Amino acid sequence that will be synthesized. Refer to the genetic code.1. DNA Template: TAC-GGC-TAC-CAT-ATG-GAGmrNa:tRNA:Amino acid sequence: 2. DNA Template: TTA-CAT-CAT-ATC-GAT-GACmrNA:tRNA:Amino acid sequence: 3. DNA Template: CTA-GCG- ATA - AAA-TTT-ATTmrNa:tRNA:Amino acid sequence:
Give typing answer with explanation and conclusion 5'ATTAGGAGGTGCGTTATGCAGGCATGTTACGTACGTACG,TAAGATAAGTACT3’ 3' TAATCCTCCACGCAATACGTCCGTACAATGCATGCATGCATTCTATTCATGA5’ In the above piece of double stranded DNA, how many potential translations start sites exist if an mRNA could be synthesized from any portion of this DNA? Indicate where they are in the DNA above and explain how you found this number.
Transcribe and translate the following DNA sequence (nontemplate strand); 5GCATGCGCGGCCATGTTGATTAAGCA 3Show and label the ends of your code for each step.
Give typing answer with explanation and conclusion to all parts Consider the following DNA mRNA sequence: 5’-ACTGATCCATGCCAGGGGTTTTCAACTAAAATGAAA-3’ a) What is the template sequence this mRNA was transcribed from? Include 5’ and 3’ labels. b) Based on this sequence, what you predict would be the resulting peptide sequence from it. c) In examining this sequence what is the proper reading frame of the open reading frame? (+1, +2, +3, -1, -2, or -3). d) What would you predict the peptide sequence to be if there was the following mutation that led to a base change: 5’-ACTGATGCATGCCAGGGGTTTTCAACTAAAATGAAA-3’
a) Complete the table below. Assume that reading is from left to right and that the columns represent transcriptional and translational alignments. Label the 5’ and 3’ ends of DNA and RNA and carboxy and amino acid ends of protein. (You may fill in this chart by hand writing- no typing necessary here.) 2. b) Is the top or bottom DNA strand the template strand?
Give typing answer with explanation and conclusion Which of the following statements regarding the structure and function of tRNA is true? A-The codon / anticodon pairing is absolutely universal among organism. B-The charging of a tRNA does not require energy. C-There are 64 different tRNAs, one for each possible codon. D-Reading 5' to 3', the first base in the anticodon can participate in non Watson and Crick base pairing E- The 3' end of each tRNA has a unique sequence so a specific amino acid can be attached.
a) Replicate this sense strand to create a double-stranded DNA helix TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT b) Using this DNA double helix, express the gene – i.e. determine the resulting polypeptide sequence by using the correct reading frame. When you get to the stop codon – you may write an asterisk (i.e. a “*”) to denote the stop codon. c) Does the sense strand DNA sequence have 5’ and 3’ UTR sequences? If so – write them in the space below 5’ UTR: 3’ UTR:
INSTRUCTION: = IF BOTH STATEMENT ARE TRUE = IF FIRST STATEMENT IS TRUE WHILE SECOND STATEMENT IS FALSE = IF FIRST STATEMENT IS FALSE WHILE SECOND STATEMENT IS TRUE = IF BOTH STATEMENTS ARE FALSE STAMENT 1: Amino acyl tRNA synthase is the enzyme responsible for joining amino acid together STAMENT 2: Nucleus is the part of the cell where translation takes place ANSWER: STAMENT 1: DNA sequences where RNA polymerase binds initially is called promoter sequences STAMENT 2: UV light causes adenine to dimerize ANSWER: STAMENT 1: Guanosine is the name of the compound formed when guanine is bonded to ribose STAMENT 2: DNA pairing is the term that refers to the process when two complementary and single stranded DNA combine ANSWER:
Give typing answer with explanation and conclusion Suppose that RNA polymerase was transcribing a eukaryotic gene with several introns all contained within the coding region. In what order would the RNA polymerase encounter the elements in the DNA sequence of the gene? Earliest encountered promoter 5' UTR translation initiation codon splice branch point stop codon 3' UTR Latest encountered

SEE MORE QUESTIONS

Recommended textbooks for you

Biochemistry

ISBN:

9781305577206

Author:

Reginald H. Garrett, Charles M. Grisham

Publisher:

Cengage Learning

Biology 2e

Biology

ISBN:

9781947172517

Author:

Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:

OpenStax

Biochemistry

ISBN:

9781305577206

Author:

Reginald H. Garrett, Charles M. Grisham

Publisher:

Cengage Learning

Biology 2e

Biology

ISBN:

9781947172517

Author:

Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:

OpenStax

SEE MORE TEXTBOOKS