3. The data in the following table represent the base composition of two double stranded DNA sources and their RNA products in experiments conducted in vitro. A+T A+U A+G Species G+C G+C C+U Bacillus subtilis 1.36 1.30 1.02 E. coli 1.00 0.98 0.80 From the above data, is it possible to determine whether the RNA of these species is copied from a single strand or from both strands of the DNA? How? (HINT: Drawing a diagram may make it easier to solve this problem). Explain how it is possible to tell whether the RNA itself is single stranded or double stranded.

3. The data in the following table represent the base composition of two double stranded DNA sources and their RNA products in experiments conducted in vitro. A+T A+U A+G Species G+C G+C C+U Bacillus subtilis 1.36 1.30 1.02 E. coli 1.00 0.98 0.80 From the above data, is it possible to determine whether the RNA of these species is copied from a single strand or from both strands of the DNA? How? (HINT: Drawing a diagram may make it easier to solve this problem). Explain how it is possible to tell whether the RNA itself is single stranded or double stranded.

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter14: Dna Structure And Replication

Section: Chapter Questions

Problem 5TYK: Which of the following statements about DNA is false? a. Phosphate is linked to the 5 and 3 carbons...

See similar textbooks

Similar questions

1. Using the gel picture of the DNA ladder, show where your digestion of the paper cutting model showing cut fragments would appear. The linear uncut DNA is 640 base pairs in length. Insert an image below.
3’atgtaccatgcgcaaatttaaaggccc5’. a) Using this single template strand of a DNA as a template, write the base sequence of the complementary strand. b) List the molecules must be present for DNA to be replicated and briefly describe their function.
1) The Nde1 enzyme comes at a concentration of 40 U/ul. According to the manufacturer, the container has enough for 10,000 reactions of 2 ug of DNA, assuming that 1 U/ug of DNA is recommended. How many units in total does the packaging contain? At what concentration in U/ml does the enzyme come? If I had to use 10 U for a reaction of 10 ugs of DNA, how would I serve it? 2) A serially diluted phage solution is used to inoculate an E coli plate in the double-layer plate assay. In 24 hours you count 148 plaques. Considering that the original stock was 0.1, and that you used the sixth dilution of the series, what is the PFU for that phage in this strain of E coli? What is the dilution factor for this plate?
When Griffith injected mice with a combination of live rough-strain and heat-killed smooth-strain pneumococci, he discovered that (a) the mice were unharmed (b) the dead mice contained living rough-strain bacteria (c) the dead mice contained living smooth-strain bacteria (d) DNA had been transferred from the smooth-strain bacteria to the mice (e) DNA had been transferred from the rough-strain bacteria to the smooth-strain bacteria
The experiments in which Meselson and Stahl grew bacteria in heavy nitrogen conclusively demonstrated that DNA (a) is a double helix (b) replicates semiconservatively (c) consists of repeating nucleotide subunits (d) has complementary base pairing (e) is always synthesized in the 5 3 direction
Which of the following statements about DNA is false? a. Phosphate is linked to the 5 and 3 carbons of adjacentdeoxyribose molecules. b. DNA is bidirectional in its synthesis. c. Each side of the helix is antiparallel to the other. d. The binding of adenine to thymine is through three hydrogenbonds. e. Avery identified DNA as the transforming factor in crossesbetween smooth and rough bacteria.
Topoisomerases (a) synthesize DNA (b) synthesize RNA primers (c) join Okazaki fragments (d) break and rejoin DNA to reduce torsional strain (e) prevent single DNA strands from joining to form a double helix
1. Genosensors are biosensors based on the principle of complementarity and hybridization of DNA strands. Which factor may be the least important in the regulation of the process? length of the DNA sequence primer length concentration of the DNA composition of the DNA sequence salt concentration temperature 2. Which of the following produces a T1-weighted image? TR = T1, TE << T2 TR >> T1, TE = T2 TR = T1, TE = 2 TR >> T1, TE << T2
3. The enzyme responsible for transcribing complementary DNA from mRNA is DNA Polymerase Reverse transcriptase RNA Polymerase Endonuclease 6. Sanger DNA sequencing relies on a method known as chain termination. Which molecule is used to terminate DNA chains to create molecules of all possible lengths covering the fragment to be sequenced? Deoxyribonucleotides Deoxyadenosine Deoxyguanosine Dideoxynucleotides
1. Below is the base sequence of protein for normal hemoglobin and the base sequence for the sickle cell hemoglobin:Normal: GGG CTT CTT TTTSickle: GGG CAT CTT TTTa. Transcribe and translate the normal and sickle cell DNA. b. Identify this as a point or frameshift mutation. Explain. c. If the base sequence read GGG CTT CTT AAA instead, would this result in sickle cell hemoglobin? Explain.
1 a)The nucleotide sequence below is one half of a double stranded DNA sequence. The highlighted portion of the sequence is where a primer will bind during DNA replication. Which of the following options best represents the primer? 3’ – GCTCGACGTTCTGCGCTGTCGGGCTATGCG – 5’ a. 3’ – CGCATAGC – 5’ b. 3’ – CGCAUAGC – 5’ c. 3’ – CGUCGAGC – 5’ d. 3’ – CGUCGAGC – 5’ e. None of the above b) Which one of the following statements is true? a. The lac repressor and catabolite activator protein are both controlled by allosteric binding b. The addition of substrate to a non-competitive inhibition reaction will repress the inhibitor c. The lac repressor is inhibited by lactose through competitive inhibition d. β-galactosidase will hydrolyze galactose to form glucose and lactose e. The x-intercept of a Lineweaver-Burk plot is the numerical value for the maximum reaction velocity
1. Which of the following are generated due to the twisting of dsDNA? a. Hydrophobic bonds b. Van der Waal forces c. Hydrogen bonds d. Grooves 2. Which of the following terms refers to the annealing of ssDNA to complementary RNA? a. Homologous combination b. Hybridization c. Denaturation d. Telomere lengthening 3. Which of the following completes this statement? The melting temperature of DNA is the temperature at which__________. a. DNA denatures b. DNA bonds are reinforced c. Solid DNA becomes liquid d. Liquid DNA coils