4. A peptide was cleaved into smaller fragments using chymotrypsin and CnBr. The fragments were separated by HPLC and then sequenced by Edman degradation. Determine the sequence of the original peptide from the following fragment sequences. Cleavage with chymotrypsin Cleavage with CnBr EAGPDGMECAF ЕCАFHR GPF CKWEAGPDGM EAAMCKW IAHTYGPFEAAM HR ТАНТY -align the peptides Reagent (source) Trypsin (bovine pancrease) Chymotrypsin (bovine pancrease) Staphylococcus V8 protease Pepsin (porcine pancrease) Cyanogen bromide (chemical)(CnBr) Specificity Lys, Arg (C) Phe, Trp, Tyr (C) Glu, Asp (C) Phe, Trp, Tyr (N) Met (C)

Q: II. Give the translation of the segment of a polypeptide chain below. Specify your template strand.…

A: The template strand is a DNA strand that functions as a template for the synthesis of complementary…

Q: sample a peptide of known sequence was treated with trypsin; another sample of the same peptide was…

A: Protein sequence analyses are experimental methods that determine the amino acid sequence of a…

Q: . Determine how many amino acids will appear on the protein encoded in a DNA segment that contains…

A: 2.  DNA SEGMENT CONTAINS = 981 NUCLEOTIDE UNITS. on transcription of DNA segment which contains 981…

Q: Apeptide was sequenced and the sequence of fragment sets generated by different cleavage methods is…

A: Amino acids are the molecules that join to form a protein structure. The bond formed between two…

Q: Can you please answer 32

A: Any alteration in the genome’s nucleotide sequence is called a mutation. It may involve small-scale…

Q: Cyanogen bromide cleavage of a peptide results in 3 fragments with the sequence: AGRFM, RS, and…

A: Cyanogen bromide (CNBr), is an inorganic pseudohalogen, which helps in modifying peptides and…

Q: 1) Complete the following tables by filling in the DNA sequence, MRNA codons, and the amino acids…

A: The genetic material DNA is converted into RNA and this mRNA codes for a specific protein which is…

Q: Let’s return to your patient with sickle cell anemia.  Below is the RNA sequence from your patient…

A: Sickle cell anemia is a recessive disorder.

Q: Which amino acid residue is preferred at which position in the following peptide for cleavage by…

A: While writing a polypeptide, the left side is the N terminus and the right side is the C terminus.

Q: 4. Indicate whether each of the following words orphrases applies to proteins, DNA, or both.a. a…

A: Deoxyribonucleic acid (DNA) is the genetic material of most organisms that contains coded genetic…

Q: 1. (a) What will be the newly synthesized DNA from the template given? DNA Template 3 -…

A: The base-pairing rule in DNA is that cytosine (C) pairs with guanine(G) and adenine (A) pairs with…

Q: 3) During charging of tRNAS Select an answer and submit. For keyboard navigation, use the up/down…

A: The translation is a process by which proteins are synthesized. It is the last step of the central…

Q: A peptide with 19 amino acid residues was digested with trypsin and generated the following…

A: The one letter code for different amino acids are :-  G - glycine I - isoleucine  R - arginine  S -…

Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…

A: In cell protein formed according to the sequence on mRNA. mRNA is formed from DNA sequence by the…

Q: 1.Which of the following RNA has a catalytic activity like an enzyme? A. MRNA C. FRNA B. tRNA D.…

A: 1. (C) rRNA 2. (A) deoxythymidine 5'-monophosphate 3. (B) they differ in pitch

Q: A sample of a peptide of unknown sequence was treated with trypsin; another sample of the same…

A: Trypsin is basically a serine protease where it hydrolyses proteins. It is synthesized in the…

Q: 1. Based on the results obtained give the differences between the hydrolyzed and unhydrolyzed RNA.

A: The monomeric units of nucleic acids are called nucleotides. Nucleotides are generally…

Q: 3. A missense mutation results in the presence of a different amino acid than was encoded by the…

A: Sickle cell anaemia is an autosomal recessive disorder.

Q: a) What was the full peptide sequence before degradation? b) Paula thought she forgot to treat her…

A: Edmans degradation is a method of sequencing the amino acids in the peptide. In this first step…

Q: Which set of fragment ions is likely from the same population of precursors ions (parent peptide)…

A: ANS:- None of the described choices are likely.

Q: True or false for these statements: a. ubiquitin molecule signals that a protein is ready to be…

A: Proteosome  is barrel saved complex structure, contain high amount of  structure that is responsible…

Q: Complete the table below showing the sequences of DNA, MRNA codons, RNA anticodons and the amino…

A: Note: As per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction: A…

Q: 1. DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ mRNA: polypeptide chain:

A: (According to our regulations, we are required to answer only the first question in case of multiple…

Q: 1.  Considering the following nucleotide sequence in an mRNA molecule: 5’ AUG UUA CGU AAU GCU GUC…

A: The genetic code is a set of three-letter combinations of nucleotides that corresponds to a specific…

Q: After treating one polypeptide with two different proteases (Trypsin and Chymotrypsin), shorter…

A: Introduction Peptides are short chains of amino acids with peptide bonds connecting them.…

Q: Assume the first nucleotide in the sequence is at the +1 position. Transcribe the DNA sequence into…

A: ANSWER;-

Q: Two complete sets of overlapping peptides, created with two different cleavage methods, are used in…

A: The technique used to determine the amino acid sequence of a protein is known as protein sequencing.…

Q: 6. Which of the following amino acid does not include post-translational modification? a.…

A: Post translational modification is a covalent and enzymatic modification which occurs after the…

Q: A short protein segment was cleaved by two different enzymes resulting in two sets of degradation…

A: Edman degradation is a method in which amino acids can be sequenced in a peptide. At first the amino…

Q: 3. DNA: TACGGGCCTATACGCTACTACT CA TG GATCGG MRNA: UC Codon: Anitcodon: Amino Acids: 4. DNA: G T…

A: Since we are entitled to answer first question, we’ll answer the question 3 as you have not…

Q: 1. Below is a sequence of DNA bases. =T ACTTCACG AGTGAGACT a) Transcribe to MRNA: AUGAAGUGCUCACUCUGA…

A: Transcription is a process in which the DNA sequence is converted to mRNA. In mRMA there is Uracil…

Q: . An oligonucleotide (a short DNA or RNA) has the following sequence: ACGTGGTTCCATGGTACGGC (a) Show…

A: The malting temperature (Tm) of the DNA  is the temperature at which at least 50% of dsDNA is…

Q: 2. Decode the hidden message from the polypeptide coded by the DNA sequence below. Express the amino…

A: The given sequence can be read by combining sets of three nucleotides per amino acids.

Q: Let’s return to your patient with sickle cell anemia.  Below is the RNA sequence from your patient…

A: The mutations can change the amino acids coded as the codon changes. The mutations can be silent…

Q: I have a mixture of 4 proteins, whose sequences are shown below (note that each protein is a…

A: Proteins or peptides are composed of twenty standard amino acids attached together via peptide…

Q: Identify a protein that can contain a temperature-sensitive mutation that would explain these…

A: The mutation is the change in the nucleotide sequence that can be due to some chemical mutagens or…

Q: A partial amino acid sequence from the tick anti-coagulant protein is:…

A: The genetic code is a set of three-letter combinations of nucleotides called codons that corresponds…

Q: 30  A DNA sequence encoding a five-amino acid polypeptide is given below.…

A: The process of translating an mRNA strand into an amino acid sequence at the time of protein…

Q: 1. Using the genetic code, determine the sequence of amino acids encoded by the mRNA codocn sequence…

A:

Q: TGTACACATGTCCGAAACAGACTTACCGAA-5

A: For the given DNA Sequence , the translated mRNA  is as follows_  3'TGTACACATGTCCGAAACAGACTTACCGAA5'…

Q: 6. Shown below are the amino acid sequences of the wild-type and three mutant forms of a protein.…

A: Hello. Since your question has multiple sub-parts, we will solve first three sub-parts for you. If…

Q: DIRECTION: Complete the DNA and RNA sequencing for the translation and creation of proteins. 1. DNA…

A: Transcription Cellular process in which RNA is synthesized using DNA as a template known as…

Q: A sample of an unknown peptide was divided into two aliquots. One aliquot was treated with trypsin;…

A: Introduction Peptides Are Short Sequences of Amino Acid Monomers Joined by Amide Bonds That Occur…

Q: 1. Suppose a protein sample with a fragment containing the following amino acid sequence is…

A: Biological macro-molecules are constituted of nucleic acids proteins lipids and carbohydrates.

Q: Protein sequences are customarily 'reconstructed from sequenced fragments because all of the above…

A: Protein sequencing is a practical method that determines the sequence of amino acids of all or some…

Q: A sample of an unknown peptide was divided into two aliquots. One aliquot was treated with trypsin…

A: Trypsin cleave the peptide on the carboxy side of arginine and lysine residues. Cyanogen bromide…

Q: .  Considering the following nucleotide sequence in an mRNA molecule: 5’ AUG UUA CGU AAU GCU GUC…

A: The central dogma of life involves three processes. They are: Replication: - In this process,…

Q: 1. A portion of the template strand of a DNA molecule that codes for the 5'-end of an mRNA has the…

A:

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.