1. In what direction does a polymerase move when synthesizing a strand of mRNA? Briefly Explain. 2. Instead of the term “Formation of a nucleoside”, what could the name of the reaction be? What functional group is being formed? Briefly Explain.
Q: 1- Biochemist Erwin Chargaff was the first to note that, in DNA, [A] = [T] and [G] = [C], equalities…
A: Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: 2. The following figure represents the primary transcript of a typical eukaryotic protein-coding…
A: The given figure shows the presence of 3 exons and 2 introns. Exon 1 starts from bp 50 to bp 600.…
Q: The peptidyltransferase reaction begins with the hydrolysis or breaking of the bond between the…
A: The translation is the process in which the genetic code carried by mRNA is decoded to produce the…
Q: 1. Given the following three mRNA sequences, which 2 sequences code for the same protein? #1 AGU UUA…
A: Translation is the phenomenon in which single stranded mRNA comes out from the nucleus and enter in…
Q: 1. Certain proteins that stimulate expression of a gene bind to DNA in a sequence specific manner…
A: Proteins are an important organic compound. Some proteins stimulate the expression of a gene bind to…
Q: 3. You have assembled a very short contig below, but you don’t know if this is the sense or…
A: Gene is the segment of DNA (deoxyribonucleic acid) that is responsible for heredity and inheritance…
Q: 2a) Suppose you have a gene in which a single base substitution has created the nonsense mutation…
A: DNA(deoxyribonucleic acid) is the genetic material in all the organisms except few viruses. The…
Q: 1.Generally, demethylation on the promoter region of a gene blocks transcription. True\False?…
A: According to the guidelines we have to answer the first 2-3 questions rest you can ask separately…
Q: 6. Let us suppose that a vertebrate organism carries a mutation that causes some cells that normally…
A: Introduction: DNA methyltransferase is a group of enzymes that transfers the active methyl group…
Q: 4A. In the human gene for the beta chain of haemoglobin (the oxygen-carrying protein in the red…
A: The genetic information always flow from DNA to RNA to proteins. This flow of information is known…
Q: 4. Is there any situation in which DNA is made based on a RNA template? If there is, explain with an…
A: Note: We will answer the first question since the exact one was not specified. Please submit a new…
Q: 1. What is the production of RNA called and what is the enzyme that catalyzes the process? 2. What…
A: “Since you have posted a question with multiple sub-parts, we will solve the first three subparts…
Q: 1.Promoters usually contain an AT-rich sequence. How is this beneficial to transcription?
A: Promoter is a specific site upstream of a gene where RNA Polymerase binds and initiates the process…
Q: 2. If you mixed the mRNA of a human gene with thegenomic DNA for the same gene and allowed theRNA…
A: The binding of single standard DNA on the basis of their complementary is known as hybridization.…
Q: the 3’-OH groups
A: Since you have asked multiple questions , we will solve the first question for you. If you want any…
Q: 4. a. A polypeptide contains 36 amino acids. How many nucleotides should be found in the open…
A: Codons are triplets of nucleotides, which codes for specific amino acids. The open reading frame is…
Q: 1b) Give the anticodon of the tRNA that would be complementary or a perfect match to the codon…
A: The codon is defined as a sequence of three nucleotide bases on messenger RNA responsible for…
Q: 1. Using the table of the genetic code, determine the sequence of amino acids. 2. If mutation occurs…
A: Codons are triplets of nucleotides in the mRNA sequence, which is read by the ribosomes in order to…
Q: 30 A DNA sequence encoding a five-amino acid polypeptide is given below.…
A: GivenA DNA sequence encoding a five-amino acid…
Q: 8. A peptide hormone consists of nine amino acids in this sequence: arg-pro-pro-gly-phe-…
A: In this question, we are given a peptide sequence which is arg-pro-pro-gly-phe-ser-pro-phe-arg. We…
Q: 1. Why Phosphate bond is important in DNA or RNA structure? 2. Why G-C forms three hydrogen bonds…
A: Molecular biology is the branch of science that studies various biological molecules like nucleic…
Q: Genotype Condition Functional Nonfunctional No Enzyme Made Enzyme Made Enzyme Made I'OʻZ" No Lactose…
A: The prokaryotic gene regulation system is known as operon system that controls the expression of a…
Q: 2. Can a strong alkali such as NaOH be used to bring about the hydrolysis of RNA? If YES, what are…
A:
Q: Define transcription and translation. Which process occurs first to make protein from DNA? 2. In…
A: Transcription is the process where RNA is synthesized from DNA. Translation is the process where…
Q: Why does a cell use deoxyribonuclease?
A: Introduction: DNA is the basis of the transformation of character from one generation to other…
Q: 5' AGGGUUUGGGAUGAAUCGACGACGAUCCUACGUACUAAGUA 3' Write the amino acid sequence for this portion of…
A: Transcription is a process through which the template DNA strand is transcribed into mRNA. mRNA…
Q: What is the chemic name and formula of the precipitate for the test for phosphate? 2.suppose biuret…
A: Dear students, As the given question has multiple questions and here it is not specified which…
Q: 4. A protein is found with the sequence Met-Thr-Tp-Phe-Lys-Cys-Arg-His-Pro-Gly, A mutant is found…
A: Mutations are change in the nucleotide sequence which results in abnormalities in the protein…
Q: 2. There is no sigma factor on the RNA polymerase II. How does RNA polymerase Il know where to start…
A: Usually in Eukaryotic transcription initiation the transcription factor identifies promoter and then…
Q: 1. A monogenic disease is a disease caused by a mutation in a single gene. For instance, sickle-cell…
A: * Sickle cell anemia is blood disorder in which red blood cells becomes mis shapen and turns into…
Q: (i) (.. From the diagram to the right of the trp repressor in its approximate binding relationship…
A: Tryptophan (trp) repressor: It's a transcription factor that regulates amino acid metabolism. The…
Q: 2ith the diagram provided please write the polypeptide. sequence obtained from the translation of…
A: INTRODUCTION Translation is the process of translating the sequence of a messenger RNA (mRNA)…
Q: 2. Given the mRNA for a protein: 5'-CCGAACGAUGGGCUAUCCCUAACCGUUU --- 3' Write the amino acid…
A: We'll answer the first question since the exact one is not specified. Please submit a new question…
Q: a) Complete the table below. Assume that reading is from left to right and that the columns…
A: In molecular biology central dogma is the mechanism which takes place from the DNA(hereditary unit…
Q: In a particular region of the genome of a certain bacterium, one DNA strand is transcribed to give…
A: 1 a) No, there wont be any problem in expressing the two genes. But in bacteria, most of the gene…
Q: Any RNA polymerase in any organism: OA Synthesizes RNA chains in the 3' to-5 direction O B. Binds…
A: A gene is a functioning heredity unit made up of DNA that provides instructions for the creation of…
Q: 4. The gene for B-galactosidase has 3,075 bp. How long would it take for the E. coli RNA polymerase…
A: Transcription is the process by which the information stored in DNA is transferred onto an RNA…
Q: 2. Assume 250 base pairs to be responsible for a particular portion of mRNA molecule. What is the…
A: bp = base pair—one bp corresponds to approximately 3.4 Å of length along the strand 1angstrom (Å),…
Q: What anticodon would a suppressor tRNA have to have to suppress a 5'UAA3' stop codon?
A: A mutation in the gene that changes its anticodon loop for a tRNA molecule can "suppress" nonsense…
Q: b. Translation translation is the process of generating polypeptide using the information carried on…
A: Flow of information in the DNA involves DNA RNA and proteins. Proteins are the ultimate machinery…
Q: Given the going with molecule of DNA: strand 1 – A T G C G C T A C G C A T–strand 2 – T A C G C G A…
A: In living organisms, the genetic instructions for growth, development, functioning, and reproduction…
Q: 2. In the given segment in problem 1, illustrate and indicate the direction of synthesis of: a.…
A: The replication process begins with the unwinding of the polynucleotide strand, which forms a…
Q: 1. why is the ribosome a good drug target? 2. Tetracyclines: a. Where do first generation…
A: 1. Ribosome is the major target for any drugs. Ribosomes mainly help in the protein synthesis of the…
Q: 1.) Define transcription and translation. How does transcription and translation differ in…
A: The organisms are differentiated on the basis of the number of cells. Unicellular organisms are…
Q: 5' - ATGGCGAGGCGGCAGCTGTTATGGTGA – 3' In the sequence above, suppose that the 20th nucleotide of the…
A: The mRNA is produced from the template strand that is oriented in 3' to 5' direction and the newly…
Q: 1.Would you expect a solution of high salt to be able to denature ribonuclease? Why or why not?
A: As there are multiple question you have asked that are not much interrelated to each other so…
Q: the human gene for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood…
A: In order to synthesize complementary strand adenine is added where thymine is present and cytosine…
Q: 4. How many codons are in the longest ORF? 5. What is the frame of the shortest ORF? 6. How many AA…
A: ORF is a stretch of DNA sequence that begins with translation initiation site (start codon) and ends…
Q: 6. Given: 3--TACTTCAAACCGGGCCCGATT--5 a) Give the sequence of nucleotides in the mRNA. b) What is…
A: The DNA is translated into mRNA by transcription process and then the mRNA is translated into…
Q: the human gene for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood…
A: DNA polymerase is the main enzyme for replication that is it synthesizes complementary strand…
1. In what direction does a polymerase move when synthesizing a strand of mRNA? Briefly Explain.
2. Instead of the term “Formation of a nucleoside”, what could the name of the reaction be? What functional group is being formed? Briefly Explain.
Trending now
This is a popular solution!
Step by step
Solved in 2 steps with 2 images
- 1. Considering the following nucleotide sequence in an mRNA molecule: 5’ AUG UUA CGU AAU GCU GUC GAA UCU AUU UGC UUU ACA UAA 3' a) Write the sequence of the DNA template (antisense) strand from which the mRNA was synthesized. b) Write the sequence of the DNA coding (sense or informational) strand complementary to the template strand. c) Write the sequence of tRNA anticodon that corresponds to the given mRNA molecule. d) Write the amino acid sequence of the peptide synthesized from the given mRNA nucleotide sequence. e) Draw the structure of the pertide fragment made up of the first five (5) amino acids in the given polypeptide.1. A region of DNA in a particular cell synthesizes a segment of RNA that is 174 bases long and in the form of a large palindrome. The RNA is transported to the cytoplasm and folds into a hairpin loop of double stranded RNA. In the cytoplasm, the hairpin loop is recognized by a double-stranded RNA cutting enzyme (dicer) and is cut into 21 BP lengths. When these 21 BP double stranded segments are combined with protein, they function by: Answer choices destroying specific mRNAs priming the synthesis of DNA sequences adding DNA to the chromosome ends (telomeres) acting as decoys for RNA degrading enzymes thus protecting the mRNAs present splicing the introns out of messenger RNA 2. The following are genotypes of merozygotes of E. coli with various combinations of lac operon mutations. Determine the phenotype with respect to beta-galactosidase (z), permease (y), and trans-acetylase (a) of each combination as U = uninducible, I = inducible, and C = constitutive. Choose from…1. What is the nucleotide sequence of the mRNA transcribed from the template DNA strand: 3’-GCTACAAAAAGTCCATAATCGC-5’? Indicate the 5’ and 3’ ends. Follow the same format as the given sequence. 2. If the mRNA sequence you obtained in question 2 were to be translated, what would be the sequence of amino acids in the peptide? Use the 3-letter code of the amino acids. Separate the amino acids with a dash (-). NO NEED to indicate the N- and C-terminal amino acids. Assumption is that the first amino acid is the N-terminal. 3. If the mRNA sequence you obtained in question 2 were to be translated, what would be the sequence of amino acids in the peptide? Use the 3-letter code of the amino acids. Separate the amino acids with a dash (-). NO NEED to indicate the N- and C-terminal amino acids. The assumption is that the first amino acid is the N-terminal.
- 1. What is the nucleotide sequence of the complementary strand of the DNA molecule: 5’-AATGCGATCTTCAT-3’?2. What is the nucleotide sequence of the mRNA transcribed from the template DNA strand: 3’-GCTACAAAAAGTCCATAATCGC-5’? Indicate the 5’ and 3’ ends.3. If the mRNA sequence you obtained in question 2 were to be translated, what would be the sequence of amino acids? Indicate the N-terminal and C-terminal amino acids.1. Assume that the ribosome has just catalyzed the formation of a peptide bond, but the ribosome has not yet translocated to the next codon. Is the polypeptide attached to the A-site tRNA or to the P-site tRNA?In the given segment 3 ’ C A G T T A C G G C T C C T A G G T T A T A A T T C G T T T C 5 ’ Illustrate and indicate the direction of the synthesis of: i. a 5-nucleotide RNA primer ii. a 5-nucleotide Okazaki fragment
- 1) Considering how readily RNA folds to form a secondary structure, why isn’t it used to store genetic information rather than double-stranded DNA? Cite multiple reasons. 2) Do miRNA and siRNA both derive from the same source? Explain.2. If you mixed the mRNA of a human gene with thegenomic DNA for the same gene and allowed theRNA and DNA to form a hybrid molecule by basecomplementarity, what would you be likely to see in the electron microscope? Your figure should includehybridization involving both DNA strands (templateand RNA-like) as well as the mRNA.1. Which of the following initially comes directly in contact with the mRNA during translation? a. 60s + 40s b. 50s + 30s c. 40s + 30s d. 60s + 50s 2. Which of the following properties of DNA confers to the presence of 5' phosphate and 3' hydroxyl terminal? a. Double helix b. Polarity c. Complementary base pairing d. Resistance to alkali hydrolysis 3. Which of the following are constant throughout the entire nucleic acid structure? a. Sugar and Phosphate b. A-T + G-C c. A-U + G-C d. Deoxyribose and Ribose
- 8. What is happening to the DNA molecule in the figure? Also, discuss the types and functions of enzyme participating in this step.1. Explain why do eukaryotic mRNAs have to be “processed” whereas most prokaryotic RNAs do not?2a) Suppose you have a gene in which a single base substitution has created the nonsense mutation 5'TAA3' (which will be transcribed into 5'UAA3' in the mRNA - but recall that mutations are changes in the DNA sequence). Name all the amino acids that could have been coded for by the original, unmutated codon at that position in the gene.