Answered: 6. A cell that has a fully replicated…

6. A cell that has a fully replicated genome with no DNA damage will enter which phase? A. The G₁ phase B. The M phase C. The interphase D. The S phase E. The Go phase

Biology: The Unity and Diversity of Life (MindTap Course List)

15th Edition

ISBN:9781337408332

Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Chapter12: Meiosis And Sexual Reproduction

Section: Chapter Questions

Problem 9SQ

See similar textbooks

Related questions

Q: In which site in the cell does a radiolabeled secretory protein first appear when tissue is…

A: When tissue is incubated briefly with radioactive amino acids, a radiolabeled protein refers to a…

Q: Inheritance of snapdragon flower color shows a pattern of incomplete dominance. Crosses between…

A: Genetic qualities are passed down through inheritance from parents to their kids, who receive all of…

Q: Place these organs in the correct order as they are located in the ruminant. > Rumen Omasum…

A: Urea is commonly used as a non-protein nitrogen (NPN) supplement in animal nutrition. As a source of…

Q: Create a dichotomous key using the genera/species: Mycale laxissima, Halichondria poa, Amphimedon…

A: A dichotomous key based on the provided genera/species and their characteristics:Growth form:…

Q: What role do microbial symbionts play in shaping the ecological interactions between plants and…

A: Microbial symbionts are microscopic organisms, such as bacteria, fungi, and viruses, that maintain a…

Q: What were the findings of this study? What was the hypothesis?

A: A system called a FOMO (Fear of Missing Out) analysis is used to evaluate the probable outcomes and…

Q: An edible vaccine has been created against Select one: O a. HIV, not approved O b. HIV, approved O…

A: The idea of an edible vaccination has recently gained traction thanks to biotechnologists. Subunit…

Q: What do you think the research question could be?

A: A research study involves conducting a series of steps logically to identify the solution to a…

Q: Imagine that you work at the medical examiner’s office for a major metropolitan city. As Chief…

A: Disease is an an abnormal condition that disrupts or adversely affect normal functioning of the…

Q: Identify the five ways that poor agriculture practices degrade our soils. Give typing answer with…

A: Agriculture sustains the global population by providing food, fiber, and other resources. When…

Q: Objective: Understand the role of risk management in helping to provide a safe and secure…

A: Risk management plays a critical role in ensuring a safe and secure environment for both employees…

Q: Describe how the use of HIV combination therapy has improved the wellbeing of infected patients.

A: The treatment for HIV is ART- Anti Retroviral Therapy. Though ART cannot completely cure HIV it can…

Q: The phylogenetic tree of the OCTN homologs below was generated with the following accession numbers…

A: A phylogenetic tree is an evolutionary tree diagram that depicts the relatedness among organisms…

Q: A study was conducted to determine the importance of Nucleoid Associated Proteins (NAPs) by deleting…

A: 1- Nucleoid-associated protein (NAPs): These are small DNA binding proteins which can alter the DNA…

Q: the Phospholipid bilayer below to diagram what steps occur during both the Photosystem 1 and 2. ke…

A: Photosynthesis is a process by which green plants prepare their own food with the help of carbon…

Q: Ms. Michi is a researcher in a renowned pharmaceutical company based in Singapore. One of the cell…

A: In the field of pharmaceutical research, maintaining contamination-free cell lines and accurately…

Q: Incorrect amino acid changes: Justin (CGC--> AGC) Patient A (GGA-->GAA) Patient B (CGG-->CCG)…

A: Amino acid changes in proteins can have significant implications for their structure, function, and…

Q: structure of offspring. B codes for regular structure while b codes for the lack of anterior…

A: This is a dihybrid cross because two characteristics are involved here. The dominant character is…

Q: Scrotum: -The the scrotum is a each sac.(DiGiuseppe, M., & Adam-Carr, C. (2012). -located inferior…

A: The scrotum is a part of the male reproductive system. It is a pouch-like structure located behind…

Q: 2. For the DNA molecule shown below, the 5' Strand of DNA is transcribed into mRNA and then…

A: Transcription is the process by which genetic information encoded in DNA is copied into a…

Q: Select one microorganism (a prokaryote, protest, or fungus) which has the potential to be used for…

A: as per our company guidelines we are supposed to answer only 1 question. Kindly repost other parts…

Q: Please match the following definitions to the correct terms B-galactosidase lactose permease Lac I…

A: Lac operon is a good example of a negative-inducible system of gene regulation. The regulator gene…

Q: Part I: 1. What similarities or connections can be seen between these seven individuals? 2. What…

A: Disease is a condition that put negative impact on an individual ' s body and disturb the normal…

Q: A cloned Bam HI DNA fragment, 3.0 kb long, was isolated in preparation for sequence determination.…

A: Restriction mapping is done by analysing and arranging the fragments that are generated by the use…

Q: What is water saturated phenol and what is its function in RNA extraction?

A: Water-saturated phenol, commonly known as phenol:chloroform:isoamyl alcohol (25:24:1), is a vital…

Q: What is the molecular weight of the three proteins used as calibration standards: RNAase, BSA and…

A: In scientific research and laboratory experiments, calibration standards are essential for accurate…

Q: The energy from Photosystem 2 and Photosystem 1 -ATP and NADPH, help break down what molecule.

A: Photosynthesis - is a process in which energy from sunlight is transformed into chemical energy that…

Q: Roughage is more digestible than forage O True O False

A: Food science combines a variety of academic fields, including biology, chemical engineering, and…

Q: onosaccharides are simple sugars composed of what saccharide molecule

A: The unit structure of carbohydrates is generally known as the saccharide. Saccharides are the…

Q: colony-forming units

A: Colony Forming Unit:It is designated as CFU.It can defined as the unit of measurement used to…

Q: Examining Table 20-4, what do you think would be the order of mutations fixed during selection in a…

A: The frequent frequency of non-synonymous to synonymous substitution in coding regions, a…

Q: Propose a model that outlines, step-by-step, events that could reasonably generate the expression of…

A: The "Eve stripe protein" refers to a specific protein called "Even-skipped" (Eve) that is involved…

Q: Draw and label a lophophore and describe how it works in suspension feeding. What three phyla…

A: Lophophorates are organisms having mouths surrounded by tentacles. These tentacles are called…

Q: .create a Graphical Abstract to summarise the role of ALP in cancer? With imag

A: Uncontrolled division of cells leading to the development of abnormal cells which have the ability…

Q: In certain plants, red flowers are dominant to white flowers. If a heterozygous plant is crossed…

Q: What woman discovered radium and polonium?

A: What is Life's Chemistry? "All living things depend on nucleic acids, proteins, lipids, and…

Q: Why is the concavity slide used in a hanging drop

A: The hanging drop technique is a microbiology and cell biology technique for observing live…

Q: A mixture of amino acid lysine, alanine, aspartic acid is subjected to an anionic exchanger…

A: In anion exchange chromatography, molecules can be separated based on their charge properties. It is…

Q: In 20 minutes, a colony of E. coli grew from 20 bacteria to 40 bacteria. At 40 minutes, there were…

A: Understanding the growth dynamics of bacterial populations is crucial for various fields, including…

Q: b) What conserved protein domain do all the above genes have? c) What, specifically, does this…

A: Since the third subpart will require an external tool, we will solve the first two sub-part for you.…

Q: 2. In a eukaryotic, photosynthetic cell, the photopigment chlorophyll a is located in the…

A: Cyanobacteria, also called "blue-green algae," are the photosynthetic bacteria. The phylum of…

Q: Frankia isolate EAN1pec respires acetate, but will not grow on acetate as a sole carbon and energy…

A: Numerous microbes can use acetate as a common carbon source and energy source. However, some Frankia…

Q: Would this be a scientific hypothesis? Golden retrievers are a better dog for children than…

A: It's vital to see each breed's interesting characteristics, temperaments, and behaviors when…

Q: Discuss how viruses are inhibited by interferons and how some viruses have evolved resistance to…

A: An infectious microbe which consists of…

Q: Your heart is a single organ, but it acts as a double pump in the human body explain this important…

A: Human circulatory system also called the blood vascular system consists of a muscular chambered…

Q: A pharmacist had 6 grams of codeine sulfate. He used it in preparing the following: 12 capsules each…

A: Codeine sulfate is a drug belonging to the class opioid analgesics, which means it is derived from…

Q: . Define "heterochrony". Explain how heterochrony may have been involved in the evolution of (or…

A: The gastropods are invertebrates and belong to the phylum Mollusca. They have a broad and muscular…

Q: Place these organs in the correct order as they are located in the ruminant. Rumen Omasum > >…

A: Ruminants, such as cows, sheep, and goats, possess a unique digestive system that sets them apart…

Q: Viruses cannot be grown in standard microbiological culture such as broth and agar. They need to be…

A: Studying viral behavior, developing vaccines, and performing diagnostic tests are all made easier by…

Q: Describe how the antigenic components of current viral vaccines are produced and describe the…

A: A coronavirus is a type of virus belonging to the family Coronaviridae. Coronaviruses are named for…

Question

6. A cell that has a fully replicated genome with no DNA damage will enter which phase?
A. The G₁ phase
B.
The M phase
C.
The interphase
D. The S phase
E. The Go phase

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1: Introduction

VIEW

Step 2: Explanation for correct and incorrect answers

VIEW

Solution

VIEW

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

1. It is S phase of the cell cycle, and time to replicate the cell’s DNA. Using the following strand of DNA as a template, create the complementary strand:GCTCCTTACGGGCCCAATGACCTGAATGTACGAGATCCCATCCTT
An organism s traits are determined by the specific combination of inherited. cells. genes. proteins. chromatids.
The failure of chromosomes to separate normally during cell division is called (a) a fragile site (b) an inborn error of metabolism (c) a satellite knob (d) a translocation (e) nondisjunction
Which of the following is not true of somatic cell gene therapy? a. White blood cells can be used. b. Somatic cells are cultured, and the desired DNA is introduced into them. c. Cells with the introduced DNA are returned to the body. d. The technique is still very experimental. e. The inserted genes are passed to the offspring.
In 2005, researcher Woo-suk Hwang reported that he had made immortal stem cells from human patients. His research was hailed as a breakthrough for people affected by degenerative diseases, because stem cells may be used to repair a persons own damaged tissues. Hwang published his results in a peer-reviewed journal. In 2006, the journal retracted his paper after other scientists discovered that Hwangs group had faked their data. Does the incident show that results of scientific studies cannot be trusted? Or does it confirm the usefulness of a scientific approach, because other scientists discovered and exposed the fraud?
3. What cell organelle of the strawberry was broken when it was crushed? a. Vacuole b. Nucleus c. Cell wall d. Ribosome 4. What is the color of the DNA extracted right after the addition of cold isopropyl alcohol? a. White b. Yellow c. Pink d. Brown
As a certain cell went through S phase, many mistakes were made during DNA replication that could not be repaired. Therefore, this cell is unlikely to? A) die B) replicate its DNA C) have mutations D) pass the G2 checkpoint E) pass the G1 checkpoint
A cell is produced with a mutation that causes it produce a completely defective TFIIH. What does this likely mean for the fate of the cell? A) The cell's copied DNA may contain more errors. B) the cell cannot make RNA C) Producing RNAs will be slower because the polymerase will fall off the DNA more often. D) The cell cannot replicate its DNA
1. A defective white blood cell does not complete the process of DNA replication. Which of the following is most likely to occur during the cell cycle for this cell? a. The white blood cell will be stopped at the G1 checkpoint and sent to the G0. b. The G2 checkpoint will stop the cell from continuing in the cell cycle. c. The white blood cell will get stuck at the spindle checkpoint. d.The cell will continue on to cytokinesis. 2. Which of the following statements describes how the RNA sequence specifies the production of an amino acid chain? a. Each set of three bases codes for an RNA molecule that specifies the anticodon. b. Each set of three bases codes for a single amino acid. c. Each base codes for one amino acid. d. Each group of three bases codes for an enzyme that binds amino acids together. 3. What will most likely happen when the -35 element and pribnow box are mutated? a. RNA Polymerase II will not be able to bind to the promoter region. b. Prokaryotic RNA…
What happens to a cell with damaged DNA? a) The cell is destroyed. b) It leaves the cell cycle to join all the other damaged cells. c) Nothing. Cells can’t tell the difference. d) A nurse cell helps to repair the cell.
At what point in the cell cycle does the amount of DNA double in a cell? A. G1 phase B. S phase C. Cytokinesis D. Metaphase 25.
After mitosis, the chromosome number of a descendant cell is_______ the parent cell’s. a. the same as c. rearranged compared to b. one-half of d. double that of