6. Several years ago, there were several reports of people suffering from unexplained headaches, shortness of breath and chest pains after eating a meal in a Chinese restaurant - the Chinese restaurant syndrome. Vetsin was under suspicion because many Chinese dishes contain large quantities of Vetsin as a flavor enhancer. Vetsin or MSG is the sodium salt of the amino acid glycine O serine methionine glutamic acid

Q: 3. An alteration of genetic information is shown below. A-G-T-A-C-C-G-A-T → A-G-T-G-A-T What type of…

A: Alteration of genetic information shown below is an example of Deletion Mutation.  In the given…

Q: 8 What are the three components of anucleotide?

A: Nucleosides are a combination of a nitrogen base with pentose sugar. The nitrogen base combines with…

Q: 3. In studying normal and mutant forms of a particularhuman enzyme, a geneticist came across a…

A: transcription is a process through which the template DNA sequence gets transcribed into mRNA. this…

Q: Translation is the flow of information from: a) DNAàDNA b) DNAà mRNA c) mRNAà polypeptide d)…

A: Introduction  Genome consists of DNA/RNA which consists of nucleotides either deoxyribose…

Q: 2. What happens during translation? is read and Possible sentence frame: Translation is the process…

A: The protein synthesis occurs in cytoplasm by the process of translation.

Q: 6. Please describe the events that may result in a mature protein not having methionine as the…

A: DNA is the carrier for genetic information in almost all organisms except certain RNA viruses. DNA…

Q: 6 What is the complement of the mRNA triplet code in the tRNA? 7 In what way is tRNA different from…

A: RNA molecules are also called ribonucleic acids. RNA is composed of nucleotides attached with each…

Q: List the amino acid sequence of the protein coded for.…

A: The translation is the process of synthesis of amino acids from the mRNA. During the translation…

Q: 4) Using the pK, data found in the supplied chart, determine the predominant charge of each amino…

A: Amino acid is amphoteric in nature i.e it can act as both acid as well as . This property is due…

Q: 7. Predict the bases that will pair with the following bases to form the complementary messenger…

A: There are basically 4 types of nitrogenous bases ATGC and in RNA thymine is replaced with Uracil.

Q: 10. Which of the following is a purely ketogenic amino acid? A. Tyrosine B. Leucine

A: Ketogenic amino acids are the amino acids that can be converted directly to acetyl CoA, which is…

Q: Loss of native conformation by a protein: a) is always reversible b) is always irreversible c)…

A: The conformation in which a molecule is active biologically is known as native conformation. In the…

Q: 1. Based on the results obtained give the differences between the hydrolyzed and unhydrolyzed RNA.

A: The monomeric units of nucleic acids are called nucleotides. Nucleotides are generally…

Q: 3. A missense mutation results in the presence of a different amino acid than was encoded by the…

A: Sickle cell anaemia is an autosomal recessive disorder.

Q: Please describe the events that may result in a mature protein not having methionine as the…

A: Translation process of formation of a sequence of amino acid using messenger RNA as a template.

Q: 5. Now imagine that a mutation occurred in the g of the codon below and the G became a C. How would…

A: point mutation - change in single nucleotide sequence which alter the amino acid .

Q: 1) What is wrong with the nucleoside shown below? Focus on the sugar portion. What sugar should be…

A: We have two types of nucleic acids namely:DNA or Deoxyribonucleic acid andRNA or Ribonucleic acid…

Q: 6. Which nucleotide in figure 1 below indicates the nucleic acid is RNA? Figure 1 a. uracil b.…

A: RNA or Ribonucleic acid is an important biomolecule present in all the biological cells and is…

Q: 7. Give all the possible Anti-codons for the amino acids listed below. Histidine (His) Isoleucine…

A: Codons is a sequence of three nucleotides that corresponds with a specific amino acid or stop signal…

Q: 3. What are the functions of lysine in human health?

A:

Q: The strength of ligand-protein binding is a property of the binding site called --------------

A: Protein has region to which ligand binds, this region is called binding site or active site . Amino…

Q: 4. The mouse deer or pilandok has shorter fur than its counterpart deer in the Arctic region. What…

A: The answer to question number 4. Introduction: Mouse deer or chevrotains are the residents of the…

Q: 6) The diagram shows a strand of DNA matched to a strand of messenger RNA. MRNA is being made from…

A: Francis crick proposed central dogma which gives the flow of genetic information from DNA to RNA to…

Q: 4. Which of the following peptides would absorb light centered at 280 nm? a. ala-lys-tyr b.…

A: The aromatic side chains of the amino acids are responsible for the absorption of UV light. The…

Q: 11. Now imagine that a mutation occurred in the second T of the codon below and the T became a G.…

A: Introduction: The genetic macromolecule referred to as DNA is highly stable with regards to its base…

Q: 6. Which of the following amino acid does not include post-translational modification? a.…

A: Post translational modification is a covalent and enzymatic modification which occurs after the…

Q: 4. Look at the picture above. What do you notice about RNA's nucleotides (base pairs) compared to…

A: DNA or deoxyribonucleic acid is the molecule that is made up of polynucleotide chains coiled around…

Q: 2. The rising of nanotechnology paved way to discover new trends, one of which is the discovery of…

A: The proteins are formed when ribosomes read an mRNA. The base triplets or codons on the mRNA are…

Q: 2 What Role Does the Amino Acid Sequence Play in ProteinStructure?

A: Proteins are the building blocks of the body. It plays an essential role in the body. Many enzymes…

Q: 2. Decode the hidden message from the polypeptide coded by the DNA sequence below. Express the amino…

A: The given sequence can be read by combining sets of three nucleotides per amino acids.

Q: In tabular form explain the specific functions of different of amino acid and how they are acquired…

A: Amino acids are organic compounds that contain amine (–NH2) and carboxyl (–COOH) functional groups,…

Q: 5. What mutation(s) would eliminate peptide translation? Nonsense mutation

A: In the given case, the sequence of DNA is given. The RNA contains uracil in place of thymine. Thus…

Q: 9) Which statement is inaccurate (wrong) about mRNA? A) it is double stranded and has thymine B) it…

A: The explanation for the wrong statement is given below.

Q: What are the components of the initiation complex for translation

A: Translation is a process in which codon of mRNA code for specific amino acid. These amino acid…

Q: 1. What is the production of RNA called and what is the enzyme that catalyzes the process?

A: Apologies. We only answer one question at a time. We will answer the first one as the exact one…

Q: 3. Today, and in the recent past, several artificial sweeteners have been used in sweetened foods…

A: Introduction :- A sweetening agent must be soluble in water and easily bind to a receptor molecule…

Q: 9. What is the purpose of the following? a) spliceosomes b) RNA polymerase c) Protein release…

A: The central dogma of molecular biology involves the processes of transcription and translation that…

Q: 4. Which of the following amino acids has an imino ring? A. Proline B. Tyrosine C. Tryptophan D.…

A: -Amino acid is made of a basic amino group, an acidic carboxyl group and an organic R group.

Q: 3. The principle theme in biology is DNA transcribes to RNA and RNA translates to proteins. Place…

A: Introduction: The process of copying the genetic information from one strand of the DNA into RNA is…

Q: How many codons are there in the mRNA?

A: Here, the given original DNA sequence is: 5'ATGCCTGGACGCAATGCGAGCTGGCTTAACTCAGGGCGTTGA3' So,the mRNA…

Q: 3. Which of the following is not a nitrogen base found in DNA? O Thymine Guanine Adenine Uracil

A: BASIC INFORMATION  CELL It is considered as the basic unit of life Every organism is made up of…

Q: 6. Shown below are the amino acid sequences of the wild-type and three mutant forms of a protein.…

A: Hello. Since your question has multiple sub-parts, we will solve first three sub-parts for you. If…

Q: 7. Guanidinium group is associated with: a. Tyrosine b. Arginine c. Histidine d. Lysine e.…

A: Amino acids are building blocks of protein and amino acids are composed of an amino group, carboxyl…

Q: 3. Which of the following does not apply to steroids? A. Some are hormones B. Composed of fatty…

A: Introduction A steroid is an organic molecule having four rings organised in a certain molecular…

Q: All antibodies are proteins. What protein property has favored their use as antibodies in preference…

A: Proteins are organic biomolecules that play an important role in various biological cellular…

Q: 12. Identify the nucleotide from the following list of nucleic acid components. A. adenosine…

A: There are many biomolecules present in the human body. Some of the biomolecules are monomers that…

Q: Write a DNA sequence that would encode the amino acid sequence…

A: In this question, we are given an amino acid sequence for which we have to determine DNA sequence.…

Q: 4. A mutation changes a nonsense codon to an amino acid sequence. Write an example of such a…

A: Mutation is any change in the sequence of DNA that causes a change in the protein that is…

Q: 1) The direction of transfer of genetic information in all living things (as defined in the central…

A: it is the process of conversion of the DNA into the functional product it explains how genetic…