7. (a) Describe the mechanism by which human cells maintain a chromosome structure that consists of overall negatively supercoiled DNA. Make sure to name the specific chromosome structures that are important for this effect.

7. (a) Describe the mechanism by which human cells maintain a chromosome structure that consists of overall negatively supercoiled DNA. Make sure to name the specific chromosome structures that are important for this effect.

Name: 7. (a) Describe the mechanism by which human cells maintain a chromos
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: 7. (a) Describe the mechanism by which human cells maintain a chromosome structure that consists ofoverall negatively supercoiled DNA. Make sure to name the specific chromosome structures that areimportant for this effect.(b) How is overall maintena

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter14: Dna Structure And Replication

Section: Chapter Questions

Problem 13TYK

See similar textbooks

Similar questions

3. Now that the sequence of the entire E. coli K12 straingenome (roughly 5 Mb) is known, you can determineexactly where a cloned fragment of DNA came fromin the genome by sequencing a few bases and matching that data with genomic information.a. About how many nucleotides of sequence information would you need to determine exactly where afragment is from?b. If you had purified a protein from E. coli cells,roughly how many amino acids of that proteinwould you need to know to establish which geneencoded the protein?c. You determine 100 nucleotides of sequence ofgenomic DNA from a different E. coli strain, butyou cannot find a match in the E. coli K12 genomesequence. How is this possible?
a. What DNA sequences are found at the telomeresof human chromosomes?b. What functions do the two telomere-associatedcomplexes, telomerase and shelterin, fulfill at chromosome ends?c. Where do you think that the RNA component oftelomerase comes from?
14. a)What is the complementary strand of TTGACAGTAAAA? b)List the possible genotypes for an individual with type A blood. c)How many chromosomes are in human beings?
8. As explained in the text, the cause of many geneticdiseases cannot yet be discerned by analyzing wholeexome/genome sequences. But in some of theseseemingly intractable cases, important clues can beobtained by looking at mRNAs or proteins, ratherthan at the DNA.a. As you will see in more detail in later chapters, it ispossible to use single-molecule methods to sequence cDNA copies of millions of mRNA molecules from any particular tissue cheaply. Howcould you sometimes use such information to finda disease gene? When would this information benoninformative?b. A technique called Western blotting allows you toexamine any protein for which you have an antibody; it is possible to see differences in size oramount of that protein. How could you sometimesuse such information to find a disease gene? Whenwould this information be noninformative?
The best estimate is that the human genome containsfewer than 21,000 genes. However, there is evidencethat human cells produce many more than 21,000 different polypeptides. What processes might account for thisdiscrepancy?
Two circular DNA molecules, which we can call molecule A andmolecule B, are topoisomers of each other. When viewed under theelectron microscope, molecule A appears more compact than molecule B. The level of gene transcription is much lower for molecule A. Which of the following three possibilities could accountfor these observations?First possibility: Molecule A has three positive supercoils, andmolecule B has three negative supercoils.Second possibility: Molecule A has four positive supercoils, andmolecule B has one negative supercoil.Third possibility: Molecule A has zero supercoils, and molecule Bhas three negative supercoils.
3’atgtaccatgcgcaaatttaaaggccc5’. a) Using this single template strand of a DNA as a template, write the base sequence of the complementary strand. b) List the molecules must be present for DNA to be replicated and briefly describe their function.
1. List the complementary non-coding DNA sequence. CCUGCAGUAUGAAACGCCUGGUAGAAGGUGGGAAGUGGUGCGCCC . . .
5’ TAAGCGTAACCCGCTAA CGTATGCGAAC GGGTCCTATTAACGCAC 3’ 3’ ATTCGCATTGGGCGATT GCATACGCTTG CCCAGGATAATTGCGTG 5’ Imagine that the double-stranded DNA molecule shown above was broken at the sites indicated by spaces in the sequence and that before the breaks were repaired the DNA fragment between the breaks was reversed. What would be the base sequence of the repaired molecule? Show the sequence, label the 5’ and 3’ ends and briefly explain the reasoning supporting your answer
6. a.) Which part (sugar, phosphate, or nitrogenous base) of the four types of nucleotides differ? b.) Based on the complementary base pairing rules we know that: A(denosine) pairs with _________ , and that G(uanine) pairs with _________.
What is meant by the term semiconservativereplication? What are the functions of DNA Pol I and III,helicase, and primase? How does a leading strand differfrom a lagging strand?
1. what will be the mRNA complimentary strand of a DNA sequence AATCGGCTGGGATTA? a. UUAGCCGACCCUAAU b. AAUCGGCUGGGAUUA c. TTAGCCGACCCTAAT d. UUTCGGCTGGGUTTU 2. what will be the amino acid sequence of DNA with a sequence AATCGGCTGGGATTA? a. leucine - alanine - aspartic acid - serine - aspagarine b. leucine - threonine - aspartic acid - serine - aspagarine c. leucine - alanine - aspartic acid - proline - aspagarine d. tyrosine - alanine - aspartic acid - proline - aspartic acid 3. what type of points mutation happened if the mutated DNA sequence is TTA-CAG-CAG-GGT-GGC? a. addition b. deletion c. insertion d. subtitution 4. if the first nitrogenous base "T" will be replaced by "G" ; what will be the resulting amino acid for the first codon? a. isoleucine b. leucine c. tyrosine d. trytophan 5. what type of point mutation happened if the mutated DNA sequence is TTS-CGC-AGG-GTG-GC? a. addition b. deletion c. insertion d. substitution