What are the frequency and percentage distribution of amino acids in the polypeptides coded by the Original DNA and the mutated DNA - (b) and DNA - (c)?
Q: Explain why are errors in DNA replication so rare, what enzymatic activity, in addition to…
A: DNA replication: Transmission of chromosomal DNA from generation to generation is achieved when DNA…
Q: 3. Now that the sequence of the entire E. coli K12 straingenome (roughly 5 Mb) is known, you can…
A: The complete genome of E.coli is 5.44 million base pairs. The genome is replicated entirely in one…
Q: 1. Why do you think SNPS are more commonly found in intergenic regions ? a.Because intergenic…
A: Single nucleotide polymorphism (SNP) is the change in the single nucleotide through addition or…
Q: What are the forces that stabilizedouble stranded DNA?
A: As DNA is i double helix structure having 2 complimentary strands, it is necessary to maintain this…
Q: How are Recombinant DNA formed?What is the difference between genetic modification and selective…
A: Recombinant DNA technology is a new approach to modify the genome of a host organism by joining two…
Q: What is the nature of genetic mutation of DNA repair proteins?
A: DNA repair proteins are those that are involved in repair of damaged or mutated DNA. Mutations can…
Q: 5. If you are able to successfully incorporate foreign DNA to your host organism, what are your…
A: A foreign DNA is a DNA that is transferred into a species from other source and not that of parent.
Q: 1) Define the silent mutation in DNA? 2) What is the codon usage bias? 3) Provide one example of a…
A: Let's consider an example: DNA strand - 5′-TAC AAA ATA CAG CGG-3′ mRNA strand – 5’ AUG UUU UAU GUC…
Q: the following mutations silent, missense, nonsense, or frameshift mutations, why? The original…
A: MUTATION:- It is the heritable change in the nucleotide sequence of the genes of an organism.. For…
Q: 28. Given the relative proportion of DNA that directly codes for genes, is it reasonable to say that…
A: Introduction :- A gene is a basic unit of heredity in biology, consisting of a sequence of…
Q: 1. Compare and contrast replication and transcription. Replication Transcription Where on the DNA…
A: DNA replication is the process of production of identical copies of DNA molecules with the help of…
Q: The functions ascribed to the genetic material are replication, expression, storage, and mutation.…
A: Genetics is a branch of the biology involved in the study of genes, genetic variation, and heredity…
Q: what is A structure composed of DNA and associated proteins that in total contain the genome of an…
A: Nucleus is a double membrane bound dense protoplasmic body which controls all cellular metabolism…
Q: What are the advantages and disadvantages of mutation?
A: "Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: What codons are found in the mRNA for the two mutated DNA
A: 1. The cell reads the sequence of the gene in groups of three bases. There are 64 different codons:…
Q: If you will use apple or strawberries instead of banana do you think the result would be the same in…
A: All living things pass hereditary information from one generation to another using DNA as the basic…
Q: 1. Which pieces of DNA are the most informative? Why?
A: as per our company guidelines we are supposed to answer only first 1question. Kindly repost other…
Q: 6. Why do you think the Ames test is preferable to the use of animal models to screen chemical…
A: Ames test is used to find whether a given chemical causes mutation in the DNA in the animal models.…
Q: 6. Assume that you are working at a biotechnology company and you are assigned to a project in which…
A: Protein purification is a set of procedures for isolating a single or a few proteins from a…
Q: 1. What is the role of salt and dishwashing liquid in the extraction/isolation of DNA from yeast and…
A: "DNA extraction or DNA isolation" is a procedure or a method wherein DNA is purified by physical…
Q: 2. Give two different reasons for the much higher ratioof total DNA to protein-encoding DNA in the…
A: DNA is a polymer of nucleotides arranged in unique sequence in different organisms. It forms the…
Q: 4. Why do the dideoxynucleotides stop DNA extension?
A: The sequences of nucleotides on the DNA strand (dNTPs) constitute the genetic code or genome. The…
Q: Describe or explain how the presence of a thymine dimer in DNA being used as the template strand…
A: The mutation is the sudden deleterious effects in the DNA sequences, they can arise when the DNA is…
Q: 1) Recombinant DNA technology and selective breeding are 2 techniques that seek to produce desirable…
A: WHAT IS RECOMBINANT DNA TECHNOLOGY AND SELECTIVE BREEDING ? - Recombinant DNA technology simply…
Q: What can you conclude about the base composition and base distribution of G-C base pairs in the…
A: DNA has a density which is weight divided by volume of about 1.7 grams per cubic centimeter (1.7 g…
Q: Why is the TP53 called the guardian of the genome?
A: Genome The genome of an organism consist of whole genetic material. The both part of gene coding…
Q: 15. How do some cells become brain cells and others become skin cells, when the DNA in ALL the cells…
A: For example, the genes for myosin and actin are present in animal cells but they are primarily…
Q: 4. A recent estimate of the rate of base substitutions atSNP loci is about 1 × 10−8 per nucleotide…
A: Base substitution is the simplest type of gene mutation that involves the swapping of one nucleotide…
Q: What is the difference between a synonomous and non-synonomous mutation? What is another name for…
A: Mutation may be defined as a sudden or abrupt change in the DNA sequence due to cell…
Q: 7) The Human Genome project cost billions of dollars to complete. What was it and do you think it…
A: For long, many people thought of the Human Genome Project as biology's "moon shot." The United…
Q: 1. Illustrate. Consider the given pair of homologous DNA molecules. W X Y W' X' Y' w' x' W X y Z…
A: A Holliday junction is a nucleic acid structure with four double-stranded arms that are linked…
Q: 8. Describe the possible outcome of a PCR experiment in which (a) one of the primers is…
A: Answer: Introduction: The polymerase chain reaction (PCR) technique, described by Kary Mullis in…
Q: Describe the features of isolated DNA of banana?
A: Introduction All living things, bananas and people included, expire information from one generation…
Q: What is the purpose of adding of (a) warm salt water, (b) detergent, and (c) alcohol on the…
A: Extraction of DNA from a banana involves mashing, filtration, precipitation and extraction.
Q: 7. Which of the following phosphates in a single-stranded DNA molecule is covalently attached to a…
A: DNA - DNA is Deoxyribonucleic Acid. It is a type of nucleic acid. It is composed of two…
Q: 13. In your own words, identify one of the reasons why it is difficult to assemble a genome and…
A:
Q: Why is it that every cell needs to contain the DNA for the entire body when only a few of its genes…
A: Aside from red blood cells and cornified cells, all other cells in the human body contain nuclear…
Q: The process of attaching biological functions to DNA sequences is called?
A: DNA is present inside the nucleus.
Q: Describe several different DNA repair mechanisms. Which ones contribute to mutations?
A: "Since you have asked multiple questions, we will solve the first question for you. if you want any…
Q: What proportion in the human genome are actual genes? 2. What are tandem repeats?
A: Introduction All of an organism's genetic data is included in its genome. It is made up of DNA…
Q: WHY DO WE NEED GENETIC ENGINEERING?
A: Genetic engineering is a vast field that mainly involves using rDNA technology to genetically alter…
Q: Describe the three-dimensional structure of DNA. 2. What is DNA denaturation?
A: a. DNA is a double-helical structure that carries the genetic information for the growth,…
Q: What is meant by ‘annotating’ the genome? How is this done? Which process occurs first? How does…
A: Asked : Genome annotation process and difference from assembly
Q: 7.What type of mutation occurred in the example above (question #6)? Did the polypeptide change? Why…
A: Any change in the sequence of the DNA molecule that brings about the change in the m RNA and…
Q: 5. Describe the method of random mutagenesis using degenerate oligonucleotide primers
A: Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: 8. As explained in the text, the cause of many geneticdiseases cannot yet be discerned by analyzing…
A: Whole-exome or genome sequences cannot be used for analyzing the cause of genetic disease. In some…
7. What are the frequency and percentage distribution of amino acids in the polypeptides coded by the Original DNA and the mutated DNA - (b) and DNA - (c)?
Step by step
Solved in 2 steps with 1 images
- 1. (a) What will be the mRNA produced from the given template? DNA Template 3 - ATTGCGGATGCCCGTATACG -5 DNA Template 3 - ATTGCGGATGCCCGTATACG -5 3 - AUUGCGGAUGCCCGUAUACG -5 5 - AUUGCGGAUGCCCGUAUACG -3 5 - AUUGCGGAUGCCCGUAUACG -3 3 - UAACGCCUACGGGCAUAUGC -5 (b) What will be the anticodons that will arrive in the translation of mRNA below? mRNA 5 - AAUAUGCGGAUGCCCGAA -3 "AAU, AUG, CGG, AUG, CCC, GAA" "UAC, GCC, UAC, GGG, CAA" "AUG, CGG, AUG, CCC, GAA" "UUA, UAC, GCC, UAC, GGG, CAA"1. (a) What will be the newly synthesized DNA from the template given? DNA Template 3 - CGGATGCCCGTATAC -5 3 - GCCTACGGGCATATG -5 5 - GCCTACGGGCATAAG -3 5 - GCCTACGGGCATATG -3 3 - CGGATGCCCGTATAC -5 (b) Which is the DNA template given if the mRNA is 5 - CGGAUGCCCGUAUACGUA -3 ? 3 - GCCTACGGGCATATGGTA -5 5 - GCCTACGGGCATAAGGAT -3 5 - GCCTACGGGCATATGCAT -3 3 - CGGATGCCCGTATACCTA -5A DNA probe with sequence TCAGGCTTCAG would bind most strongly to which of the following DNA fragments? a. AGTCCGAAGTC c. GACTTCGGACT b. TCAGGCTTCAG d. UGAGGCUUGAG
- 5’ TAAGCGTAACCCGCTAA CGTATGCGAAC GGGTCCTATTAACGCAC 3’ 3’ ATTCGCATTGGGCGATT GCATACGCTTG CCCAGGATAATTGCGTG 5’ Imagine that the double-stranded DNA molecule shown above was broken at the sites indicated by spaces in the sequence and that before the breaks were repaired the DNA fragment between the breaks was reversed. What would be the base sequence of the repaired molecule? Show the sequence, label the 5’ and 3’ ends and briefly explain the reasoning supporting your answerTranscribe an mRNA sequence from this TEMPLATE STRAND of DNA 3' CGTACGTGTATCCCATCC 5' 5' GCAUGCACAUAGGGUAGG 3' 5' GCAUGCACAUAGGGUAGG 3' 3' CGUACGUGUAUCCCAUCC 5' 5' GCATGCACATAGGGTAGG 3' 3' CGTACGUGTATCCCATCC 5'1. what will be the mRNA complimentary strand of a DNA sequence AATCGGCTGGGATTA? a. UUAGCCGACCCUAAU b. AAUCGGCUGGGAUUA c. TTAGCCGACCCTAAT d. UUTCGGCTGGGUTTU 2. what will be the amino acid sequence of DNA with a sequence AATCGGCTGGGATTA? a. leucine - alanine - aspartic acid - serine - aspagarine b. leucine - threonine - aspartic acid - serine - aspagarine c. leucine - alanine - aspartic acid - proline - aspagarine d. tyrosine - alanine - aspartic acid - proline - aspartic acid 3. what type of points mutation happened if the mutated DNA sequence is TTA-CAG-CAG-GGT-GGC? a. addition b. deletion c. insertion d. subtitution 4. if the first nitrogenous base "T" will be replaced by "G" ; what will be the resulting amino acid for the first codon? a. isoleucine b. leucine c. tyrosine d. trytophan 5. what type of point mutation happened if the mutated DNA sequence is TTS-CGC-AGG-GTG-GC? a. addition b. deletion c. insertion d. substitution
- Which of the following pairs of sequences might be found at the ends of an insertion sequence? a. 5′–GGGCCAATT–3′ and 5′–CCCGGTTAA–3′ b. 5′–AAACCCTTT–3′ and 5′–AAAGGGTTT–3′ c. 5′–TTTCGAC–3′ and 5′–CAGCTTT–3′ d. 5′–ACGTACG–3′ and 5′–CGTACGT–3′ e. 5′–GCCCCAT–3′ and 5′–GCCCAT–3′1. a) If one DNA segment has the following base composition, 5'-CAGTTAGTCA-3', which of the following sequences is complementary? op 1: 3'-CAGTTAGTCA-5' op 2: 3'-TGACTAACTG-5' op 3: 5'-TGACTAACTG-3' op 4: 3'-TGACTAACTG-5' b) What is the nucleotide sequence of the DNA strand that is complementary to 5'-ATCGCAACTGTCACTA-3' op 1: 5'-TAGCGTTGACAGTGATA-3' op 2: 5'-TAGTGACAGTTGCGAT-3' op 3: 5'-ATCACTGTCAACGCTA-3' op 4: 5'-UAGUGACAGUUGCGAU-3'Write down the double stranding sequence of the resulting DNA fragment(s) if the following DNA molecule were digested with XhoI: 5'-GGTATCCGCGGAGCTCAAATA-3' 3'-CCATAGGCGCCTCGAGTTTAT-5'
- Below is a sample of a segment of DNA…(copy from left to right) 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ 1.Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would this have on the protein? Look up an example for this type of mutation. 2, Assume the 5th and 6th amino acids are removed from the DNA template strand. What type of mutation is this? How would this affect the protein? Look up an example of this type of mutation. 3.Which mutation changes the protein more...a point mutation or a frameshift mutation. Explain your reasoning. 4.What would be the problem if ATT was inserted into the DNA template strand after the second codon? (Be sure to consult the coding chart for amino acids). 5. What if the second amino acid was repeated over 5Ox. What amino acid is repeated? What type of mutation is this? If this is on chromosome 4, what genetic disorder is this?…Consider the following segment of DNA, which is part ofa much longer molecule constituting a chromosome:5′.…ATTCGTACGATCGACTGACTGACAGTC….3′3′.…TAAGCATGCTAGCTGACTGACTGTCAG….5′If the DNA polymerase starts replicating this segmentfrom the right,a. which will be the template for the leading strand?b. Draw the molecule when the DNA polymerase ishalfway along this segment.c. Draw the two complete daughter molecules.d. Is your diagram in part b compatible with bidirectional replication from a single origin, the usual modeof replication?Please asap Original DNA template: 3'-ACGGTCAATTTGCTG-5 a) Transcribe the sequence. b) Translate the sequence. c) What type of mutation is present in the strand 3 '- ACGGTCAATATTGCTG - 5 d) Provide the entire mutated sequence of amino acids. e) Explain the effect that this mutation will have.