3. For each of the following characteristics, list all of the bases (A, B, C, or D) to which they apply. (a) A signal that identifies a parental DNA strand in the MutH,L,S mismatch correction system (b) Most likely to be involved in cyclobutane dimer formation after A B D HN-CH3 o-CH3 NH2 CH3 CH3 HN HN ultraviolet irradiation of DNA H,N (c) A methylated base found immediately to the 5' side of dGMP residues in eukaryotic DNA (d) Created by treating DNA with alkylating agents that transfer methyl groups and repaired by an "enzyme" that functions only once in its lifetime (e) Created by AdoMet-dependent methylation of a nucleotide residue in DNA (f) A substrate for deamination at the DNA level, which would lead to a GC→ AT transition

3. For each of the following characteristics, list all of the bases (A, B, C, or D) to which they apply. (a) A signal that identifies a parental DNA strand in the MutH,L,S mismatch correction system (b) Most likely to be involved in cyclobutane dimer formation after A B D HN-CH3 o-CH3 NH2 CH3 CH3 HN HN ultraviolet irradiation of DNA H,N (c) A methylated base found immediately to the 5' side of dGMP residues in eukaryotic DNA (d) Created by treating DNA with alkylating agents that transfer methyl groups and repaired by an "enzyme" that functions only once in its lifetime (e) Created by AdoMet-dependent methylation of a nucleotide residue in DNA (f) A substrate for deamination at the DNA level, which would lead to a GC→ AT transition

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter12: Dna: The Carrier Of Genetic Information

Section: Chapter Questions

Problem 7TYU: The experiments in which Meselson and Stahl grew bacteria in heavy nitrogen conclusively...

See similar textbooks

Similar questions

The results of a paternity test using short tandem repeats are listed in the table below. Whos the daddy? How sure are you?
1. a) If one DNA segment has the following base composition, 5'-CAGTTAGTCA-3', which of the following sequences is complementary? op 1: 3'-CAGTTAGTCA-5' op 2: 3'-TGACTAACTG-5' op 3: 5'-TGACTAACTG-3' op 4: 3'-TGACTAACTG-5' b) What is the nucleotide sequence of the DNA strand that is complementary to 5'-ATCGCAACTGTCACTA-3' op 1: 5'-TAGCGTTGACAGTGATA-3' op 2: 5'-TAGTGACAGTTGCGAT-3' op 3: 5'-ATCACTGTCAACGCTA-3' op 4: 5'-UAGUGACAGUUGCGAU-3'
1. List the complementary non-coding DNA sequence. CCUGCAGUAUGAAACGCCUGGUAGAAGGUGGGAAGUGGUGCGCCC . . .
1. What are the considerations we need to consider in introducing recombinant DNA in plant calli and in animal cell lines? (Give at least three considerations) Explain and answer this comprehensively.
1. What can you conclude about the base composition and base distribution of G-C base pairs in the bandicootgenomic DNA from this result? Briefly explain how or why you would reach those conclusions.
1. Why is that DNA polymerase and RNA polymerase can synthesize polynucleotides only from 5' to 3' to direction?
1. Are each of the following mutations silent, missense, nonsense, or frameshift mutations, why? The original coding DNA strand is: 5’-ATGGGACTAGATACC-3’. 2. 5’-ATGGGTCTAGATACC-3’ 3. 5’-ATGGGACTAAGATACC-3’ 4. 5’-ATGTGACTAGATACC-3’ 5. 5’-ATGGGACTAGTTACC-3’
2) The authors investigate if the switch from the polymerase to the exonuclease site involves releasing and re-binding of the DNA or if it utilizes an intramolecular rearrangement. To accomplish this, they use a primer-extension assay. How is a primer extension assay performed? In answering this question, be sure to mention a.) why heparin is used, b.) how they generate mismatched primers, and c.) how they visualize only the primer strand and not the template strand on their gel.
2) Considering the technologies that pave the way for the identification of molecules on the basis of hybridization in the classical sense, within the scope of Recombinant DNA Technology; (20P) a) Which of these is used to identify which macromolecule,b) What do you understand in the context of hybridization and between which molecules there are technique-specificinteractions take placec) “Nylon membrane” or “nitrosdulose” commonly used in these technologieswhy "membranes" are needed,d) Explain how to design an application example for each technique you mentioned.
1. Suggest reasons for why DNA mutations are not all phenotypic. 2. A mutant bacteria has been found which lacks all DNA methylation enzymes. How would this mutation affect the fidelity of mismatch repair?
8. As explained in the text, the cause of many geneticdiseases cannot yet be discerned by analyzing wholeexome/genome sequences. But in some of theseseemingly intractable cases, important clues can beobtained by looking at mRNAs or proteins, ratherthan at the DNA.a. As you will see in more detail in later chapters, it ispossible to use single-molecule methods to sequence cDNA copies of millions of mRNA molecules from any particular tissue cheaply. Howcould you sometimes use such information to finda disease gene? When would this information benoninformative?b. A technique called Western blotting allows you toexamine any protein for which you have an antibody; it is possible to see differences in size oramount of that protein. How could you sometimesuse such information to find a disease gene? Whenwould this information be noninformative?
4. A recent estimate of the rate of base substitutions atSNP loci is about 1 × 10−8 per nucleotide pair pergamete.a. Based on this estimate, about how many de novomutations (that is, mutations not found in the genomes of your parents) are present in your own genome?b. Where and when did these de novo mutations inyour genome most likely occur?