(D) An experiment by Gobind Har Khorana and his colleagues used a synthetic RNA sequences consisting of multiple repeats of the trinucleotide UUG. 8. How many reading frames are possible in this RNA? What are the amino acid sequences that result from use of each reading frame? а. b.

(D) An experiment by Gobind Har Khorana and his colleagues used a synthetic RNA sequences consisting of multiple repeats of the trinucleotide UUG. 8. How many reading frames are possible in this RNA? What are the amino acid sequences that result from use of each reading frame? а. b.

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter19: Genomes And Proteomes

Section: Chapter Questions

Problem 1ITD: Below is a sequence of 540 bases from a genome. What information would you use to find the...

See similar textbooks

Related questions

Q: Shown below is a portion of a wild-type DNA sequence that encodes the last amino acids of a protein…

A: Transcription is a process from central dogma where a DNA strand is used as a template to synthesize…

Q: Using the genetic code, indicate which polypeptides would be synthesized if poly-UGG were used in a…

A: Polypeptides are the linera chain of Amino acids Synthesised according to the codons on mRNA.…

Q: Given the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change…

A: Mutations are the abrupt changes in the DNA sequences due to wrong reading of the DNA polymerase…

Q: 1.) if the B chain of human hemoglobin is 146 amino acids in length, calculate the minimum # of…

A: The fundamental task of delivering oxygen from the lungs to bodily tissues is performed by red blood…

Q: How do eukaryotic and prokaryotic RNA polymerases compare? Despite their added complexity,…

A: RNA polymerase is an enzyme which is responsible for the transcription process, that takes place in…

Q: Which of the following would restore a gene back to its proper reading frame? A. one insertion that…

A: A frameshift mutation is a genetic mutation caused by the insertion of deletion of a number of…

Q: a. In your claim words, depict the contrast between ρ-dependent and ρ-independent end of translation…

A: ρ-dependent is basically a translation termination mechanism occuring in prokaryotic cells. Here ρ…

Q: A molecular geneticist hopes to find a Gene in human liver cell that codes for an important…

A: In heredity, gene occupies the basic physical and functional unit. They are found to be composed of…

Q: A molecular geneticist hopes to find a gene in human liver cells that codes for an important…

A: With the help of the Human Genome Project, it has now become possible to sequence all of the genes…

Q: A researcher was mutating prokaryotic cells by inserting segments of DNA. In this way, she made the…

A: a.) Mutant is the palindromic sequence for original construct. Palindromic sequences are those…

Q: After Drosophila DNA has been treated with a restriction enzyme, the fragments are inserted into…

A: a) By preparing a probe using the actin amino acid sequence or using the actin gene sequence known…

Q: You have sequenced the genome of the bacterium Salmonella typhimurium, and you are using BLAST…

A: a. The codon has a property which is known as degeneracy of the codon .This means that the codons…

Q: The earliest work on the genetic code established UUU, CCC, and AAA as the codons for Phe, Pro, and…

A: The genetic code can be defined as a set of rules. The information is encoded in the genetic…

Q: What do you mean by cross-exon recognition complex ?

A: CROSS - EXON RECOGNITION COMPLEX : The sequence of DNA present in mature messenger RNA some of which…

Q: The following represent deoxyribonucleotide sequences in the template strand of DNA: Sequence 1:…

A: BASIC INFORMATION TRANSCRIPTION It is responsible for the formation of hnRNA which has the codes…

Q: Human genomic libraries used for DNA sequencing are often made from fragments obtained by cleaving…

A: Genomic Libraries are a set of collections of genomic DNA data particular to a species/organism. The…

Q: You obtain the DNA sequence of a mutant of a 2-kb gene in which you are interested and it shows base…

A: the mutation is the change or error that is caused in the chromosome it is of a different type 1.…

Q: σ factors bind to what types of sequences on DNA? a. Shine-Delgarno sequences. b. TATA box…

A: Sigma (σ) factor of RNA polymerase holozyme is a DNA binding promoter that determines transcription…

Q: DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ Add an A before codon 3 or delete the middle base in…

A: A frameshift mutation occurs in the DNA sequence due to either addition or deletion of DNA bases…

Q: Define FOUR (4) types of point mutations within coding sequences

A: Coding sequences are the sequence of nucleotides in DNA capable to produce a protein. Many mutations…

Q: A molecular geneticist hopes to find a gene in human liver cells that codes for an important…

A: A desired gene is defined as the insertion of copies of the gene into the living cells in order to…

Q: Shown here is a theoretical viral mRNA sequence 5′-AUGCAUACCUAUGAGACCCUUGGA-3′ (a) Assuming that it…

A: Introduction:Gene is a region of DNA that encodes for proteins. DNA is transcribed into mRNA which…

Q: In order to target a specific region of genomic DNA with CRISPR, researchers must include a guide…

A: Abstract The CRISPR-Cas9 system, naturally a defense mechanism in prokaryotes, has been repurposed…

Q: For the below sequence, where the +1 site is in bold underline and the +10 and -10 sites are also…

A: Option 1 i.e. 5' AUA 3' is the correct answer.

Q: When researchers obtain genomic sequence data from organisms with little known genetic information,…

A: The central dogma of life includes the following processes: Replication: In this process, the DNA…

Q: How do eukaryotic and prokaryotic RNA polymerases compare? a. Since eukaryotic RNA polymerases are…

A: Transcription in prokaryotes and eukaryotes is different in many aspects. Eukaryotic transcription…

Q: 1. b. What is the sequence of the mRNA produced from this gene? Label the 5' and 3' ends 5'…

A: Gene is a hereditary units that are involved in sending hereditary instructions from parents to…

Q: A molecular geneticist hopes to find a gene in human liver cells that codes for an important…

A: The nucleotides sequence of the small part of the gene of interest is GTGGACTGACA as given in the…

Q: Let’s suppose a researcher mixed together nucleotides with the following percentage of bases: 30% G,…

A: DNA full form is deoxyribonucleic acid. DNA is the main constituent of the chromosome. It contains…

Q: Transcribe the DNA strand given above to write the sequence of the mRNA strand in the 5’ to 3’…

A: According to Bartleby guidelines, we are required to attempt first three sub-parts in case of…

Q: Refer to the DNA sequence provided: 3’ -TACTGAAGCGGCAGCCCCGCATGAGTAGACCTTACT-5’ a. What is the mRNA…

A: Gene expression is the process by which the instructions in our DNA are converted into a functional…

Q: Give the RNA molecule sequence transcribed from the following DNA sequence of a eukaryotic gene and…

A: DNA stands fo deoxyribonucleic acid. It is the genetic material.

Q: In the human genome for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood…

A: Hemoglobin present in red blood cells helps in the transport of oxygen molecule to and from various…

Q: Explain what is meant by stating that the genetic code is triplet and nonoverlapping? What did the…

A: The genetic code may be defined as the exact sequence of DNA nucleotides read as three letter words…

Q: Translate this RNA sequence into an amino acid sequence: 5'-AUG GGC UAC CGA-3'?

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: The A+T: G+C ratios in the DNA of cattle and rats are very similar. Would you expect the tRNAs,…

A: Chargaff's rules note that purine and pyrimidine bases in DNA from any type of organism should have…

Q: We are given a random DNA sequence (each of the 4 bases has equal probability of occurring at each…

A: As you have posted multi-part question.I am answering only first 3. For remaining answers post them…

Q: Identify where the base pair change occurs (what letters changed?) 2.) For BOTH sequences, write…

Q: How might a single base substitution in the sequence of a gene affect the amino acid sequence of a…

Q: n the human gene for the beta chain of hemoglobin, the first 30 nucleotides in the amino acid coding…

A: There are two types of the strand, i.e., the coding strand and the template strand present in the…

Q: Which of the following mutations would have the greatest negative impact on the protein product of a…

A: Mutations are studied to understand the genetic mechanism behind the development of the disease.…

Q: Exceptions to the universality of the genetic code were once thought to be rare, but more and more…

A: The genetic code consists of a triplet code, in which three nucleotides encode a single amino acid…

Q: A biochemist was able to sequence a DNA found in a human sample from humans who were first believed…

A: The DNA is a self-replicating structure formed of two strands. The DNA is formed of nucleotides. The…

Q: Computer programmers, working with molecular geneticists, have developed programs that can identify…

A: Transcription is the process by which the information in a strand of deoxyribonucleic acid (DNA) is…

Q: The following represent deoxyribonucleotidesequences in the template strand of DNA:Sequence 1:…

A: DNA is a hereditary molecule found in cells that transmits genetic information from one generation…

Q: AAGTCAAGAAGAAGAAGAAGCC A. The nucleotide sequence above is a STR of how many repeats? B. What…

A: Short Tandem Repeats(STR) or microsatellites or simple sequence repeats(SSR) are short sequences of…

Q: a molecular geneticist hopes to find a gene in human liver cells that codes for an important…

A: As given in the question, there is a particular gene in the human liver cells that quotes for an…

Q: The human genome contains thousands of sequences known as small open reading frames, some of which…

A: Deoxyribonucleic acid (DNA) is a genetic material and it carries genetic information from one cell…

Q: A hypothetical base sequence of an RNA molecule is5′–AUUUGCCCUAGCAAACGUAGCAAACG–3′What topic in…

A: Answer: Introduction: RNA molecule consists of four nucleotide bases these are adenine (A), cytosine…

Concept explainers

Microbial Taxonomy

Taxonomy is the science of naming, classifying, and describing organisms. The taxonomy will include all the plants, microorganisms, and animals on this planet. Carl Linnaeus coined the taxonomy term. He is known as the father of taxonomy. Microbial taxonomy is a criterion of grouping microorganisms into groups based on their similarities and past relatedness. Microorganisms belonging to the same group are differentiated from the others via grouping into categories. This differentiation makes the study of microorganisms easy. There are different types of microbial taxonomies like Numerical and Molecular taxonomy. The study of microorganisms is known as microbiology. Microbiology is a broad term that takes into account microbial cultures, taxonomic studies, evolutionary relationships. Microbial interaction and diversity are huge data that needs to be compiled under the subject of microbiology. Microbiology covers various organisms like bacteria, fungi, algae, plants, animals, etc.

Question

Need Help.

(D) An experiment by Gobind Har Khorana and his colleagues used a synthetic RNA
sequences consisting of multiple repeats of the trinucleotide UUG.
8.
How many reading frames are possible in this RNA?
What are the amino acid sequences that result from use of each reading frame?
а.
b.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1 mRNA

VIEW

Step 2 a) b) ANSWERS

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Shown below is an R loop prepared for electron microscopy by annealing a purified eukaryotic messenger RNA with DNA from a genomic clone containing the full-length gene corresponding to the mRNA. (a) How many exons does the gene contain? How many introns? (b) Where in this structure would you expect to find a 5′,5′-internucleotide bond? Where would you expect to find a polyadenylic acid sequence?
Refer to the DNA sequence provided: 3’ -TACTGAAGCGGCAGCCCCGCATGAGTAGACCTTACT-5’ a. What is the mRNA transcript of the anticoding strand of the DNA model? b. What is the amino acid sequence of the polypeptide chain that will be translated from the mRNA in (a)?
Consider the following portion of mRNA produced by the normal order of DNA nucleotides: 5’ – CUU AAA CCA GUU – 3’ a. What is the template DNA sequence that was used to synthesize this portion of mRNA? b. What is the amino acid order produced from this mRNA? c. Write the amino acid sequence if a mutation changes CUU to CAU. Is this likely to affect protein function?
The following represent deoxyribonucleotidesequences in the template strand of DNA:Sequence 1: 5'@CTTTTTTGCCAT@3'Sequence 2: 5'@ACATCAATAACT@3'Sequence 3: 5'@TACAAGGGTTCT@3'(a) For each strand, determine the mRNA sequencethat would be derived from transcription.(b) determine the amino acidsequence that is encoded by these mRNAs.(c) For Sequence 1, what is the sequence of the codingDNA strand?
Shown below is a portion of a wild-type DNA sequence that encodes the last amino acids of a protein that is 270 amino acids long. The first three bolded base pairs indicate the frame and include the coding region. 5^ ...GCTAAGTATTGCTCAAGATTAGGATGATAAATAACTGG 3^ 3^.. CGATTCATAACGAGTTCTAATCCTACTATTTATTGACC 5^ Which strand is the template strand for transcription of this gene? Briefly explain how you know. An insertion of one base pair causes the protein to decrease in length by seven amino acids. With respect to the sequence given above, where does this insertion occur? A change of one base pair leads to the protein increasing in the length by one amino acid. With respect to the sequence given above, which base pair would you change, and what would you change this base pair for the protein to increase in the length by one amino acid?
Given the template DNA sequence: 3’ - TAC - CAG - GTT - ACC - ATC - 5’ A.) What will be the mRNA requence corresponding to the template DNA sequence? B.) What is the amino acid sequence in letter A? ( e.g. Arg, Phe, etc.) C.) If the coding sequence of the dsDNA will "serve" as the template for transcription, what is the corresponding mRNA sequence? D.) With the mRNA transcript in letter C, what will be the amino acid sequence? ( e.g. Arg, Phe, etc.)
In the human gene for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood cells), the first 30 nucleotides in the amino-acid-coding region is represented by the sequence: 3'-TACCACGTGGACTGAGGACTCCTCTTCAGA-5'. What is the sequence of the partner strand? 4B. If the DNA duplex for the beta chain of haemoglobin above were transcribed from left to right, deduce the base sequence of the RNA in this coding region.
In the human gene for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood cells), the first 30 nucleotides in the amino-acid-coding region is represented by the sequence: 3'-TACCACGTGGACTGAGGACTCCTCTTCAGA-5'. What is the sequence of the partner strand? 4B. If the DNA duplex for the beta chain of haemoglobin above were transcribed from left to right, deduce the base sequence of the RNA in this coding region. 4C. In NOT more than 200 words, explain how eukaryotic RNA synthesized by RNA polymerase II is modified before leaving the nucleus?
How might a single base substitution in the sequence of a gene affect the amino acid sequence of a protein encoded by the gene, and why? A - It is not possible for a single base substitution to affect protein structure, because each codon is three bases long. B- The amino acid sequence would be substantially altered, because the reading frame would change with a single base substitution. C - Only a single amino acid could change, because the reading frame is unaffected. D- All amino acids following the substitution would be affected, because the reading frame would be shifted.
In a particular region of the genome of a certain bacterium, one DNA strand is transcribed to give rise to an mRNA for protein A and the other DNA strand is transcribed to give rise to an mRNA for protein B. a) Would there be any problem in expressing the two genes? 2. b) If a mutation occurred to affect the structure of protein A, what would you observe in the structure of protein B?
The following represent deoxyribonucleotide sequences in the template strand of DNA: Sequence 1: 5′-CTTTTTTGCCAT-3′ Sequence 2: 5′-ACATCAATAACT-3′ Sequence 3: 5′-TACAAGGGTTCT-3′ (a) For each strand, determine the mRNA sequence that would be derived from transcription. (b) Using Figure 12–7, determine the amino acid sequence that is encoded by these mRNAs. (c) For Sequence 1, what is the sequence of the partner DNA strand?
The human genome contains thousands of sequences known as small open reading frames, some of which encode proteins of about 30 amino acids. What is the minimum number of nucleotides required to encode such a protein?