For the next two questions, refer to the diagram of a replication bubble. Various regions of the bubble are pointed out (I-VI), but the newly synthesized strands are not shown. In which pair of regions is DNA ligase most active? I II 5' 3' 5' 3 III IV V VI O Il and III O l and IV O V and VI O Il and IV I and III
Q: Which of the following statements is true regarding DNA replication? Select all true statements. DA…
A: DNA replication is a process by which two identical copy of DNA is produced from single original DNA…
Q: After 3 rounds of replication, what percent of the DNA molecules will contain only 15N? You take a…
A: deoxyribonucleic acid, or DNA, is a biological macromolecule that carries hereditary information.…
Q: Draw a replication bubble with both replication forks and label the origin of replication, the…
A:
Q: The figure at the right shows a partially drawn replication fork. a) Annotate this figure to show…
A: In DNA replication the replication fork is an active area. When DNA helicase unwinds the double…
Q: Which letter represents the following structures: (0.5X6) Okazaki fragment Replication fork Leading…
A: The given image is representing the process of DNA replication that occurs inside the cell before…
Q: Match each statements below with the appropriate letter from the replication fork diagram. 1.…
A: 1. Removal of RNA primers and joining of Okazaki fragments. Because of its 5′ to 3′ exonuclease…
Q: Why does the DNA replication happen in the 5`-3` direction instead of the 3`-5`
A: DNA replication is the biological process by which DNA synthesis two identical replicas of itself…
Q: 1 Annotate Figure 16.5, which is a schematic of the replication fork. a. In each box, write the name…
A: DNA replication The process by which DNA duplicate itself.
Q: Below is a picture of a single origin of replication in a eukaryotic cell. 5' 37 5' 1. On the figure…
A: DNA replication is the process by which new DNA strands are produced from the old DNA molecule by…
Q: Shown below is a double stranded DNA molecule.Replicate this DNA and show the products formed from…
A: DNA REPLICATION :- It is the process by which DNA makes a copy of itself during cell division. The…
Q: Fill in the blanks in the paragraph about DNA replication. DNA replication begins at the…
A: Central Dogma concept revolves around the three processes of Replication, Transcription and…
Q: Using 14N isotope medium for DNA replication instead of 15N, what would be observed ifDNA…
A: DNA replication is the process of copying the DNA molecule using parental DNA molecule as template.…
Q: Which of the following are differences between prokaryotic DNA replication and eukaryotic DNA…
A: Replication is the process of producing two daughter identical copies of DNA from one original…
Q: Which of the following statements about replication is false?
A:
Q: Figure 9.10 You isolate a cell strain in which the joining together of Okazaki fragments is impaired…
A: DNA replication in eukaryotes is semiconservative, semicontinuous, and bidirectional. It occurs in…
Q: The small pocket of area near the replication fork that contains associated enzymes and proteins…
A: It is the process by which a double stranded DNA is copied to produce two identical DNA molecules.
Q: Which of the following is not a feature of eukaryotic DNA replication? a. Replication bubbles move…
A: DNA (deoxyribonucleic acid) is the genetic material of an organism. The specific nucleotide sequence…
Q: Shown below is a hypothetical replication bubble. In what direction does the new strand that uses…
A: In the given image, we are shown the process of DNA replication in which new strands are synthesized…
Q: Which one of the following options most accurately states the number of replication forks expected…
A: Replication is the process of formation of an exact copy or replica of DNA. It occurs under the…
Q: (a) What is the function of helicase in DNA replication? (b) What is the function of DNA polymerase?…
A: DNA is called deoxyribonucleic acid. DNA act as genetic material in most organisms. DNA replication…
Q: . Draw a replication bubble with both replication forksand label the origin of replication, the…
A: The area where the replication of DNA occurs called replication fork. When double helix is opened…
Q: What would be the a.) Product of replication b.) Product bof transcription of the following fragment…
A: Deoxyribonucleic acid or DNA is a type of nucleic acid present in the nucleus of the cell. It is a…
Q: 1) Fill in any replicated nucleic acids, using at least 2 Okazaki fragments where appropriate, Label…
A: DNA (Deoxyribonucleic acid) replication refers to the process that forms two identical DNA strands…
Q: What is the BEST explanation for why DNA replication is discontinuous at the lagging strand? А. DNA…
A: DNA possesses information for an individual to develop, survive and reproduce. The hetero catalytic…
Q: Match each protein involved in DNA replication with its correct function in E. coli. An answer can…
A: DNA replication is the molecular process involving different enzymes in different steps of…
Q: Figure 9.10 You isolate a cell strain in which the joining together of Okazaki fragments is impaired…
A: The process of creating a copy of DNA is referred to as DNA replication. In a eukaryotic cell, this…
Q: Which of the following is not depicted in the diagram attached? A. Okazaki fragment B. Replication…
A: Origin of replication is not depicted in the diagram. An origin of replication is a sequence of DNA…
Q: On the right of the replication fork, which DNA strand (top or bottom) will be the template for…
A: Okazaki Fragments these are short stretches of DNA produced by a discontinuous synthesis of the…
Q: DNA that has been labeled with 15N is used as the template for replication. Replication is carried…
A: Watson and Crick proposed that the double-strand DNA (dsDNA) replication is a semiconservative…
Q: Which of the following is not depicted in the diagram?* O Okazaki fragment O Replication fork O…
A: The diagram is showing ongoing Replication. Replication is the process by which double stranded DNA…
Q: Given the diagram of the replication fork below, indicate the chemical group (5'-P, 3'-P, 3'-OH or…
A: Replication is the process of duplication of DNA. It is a highly efficient process that requires a…
Q: 5' 3' For numbers 6 to 10, refer to the image above and answer the questions. 6. Which among the two…
A: Hi! Thanks for your question. As you have posted multiple questions and have not mentioned which one…
Q: Using penci, you will draw a representation of DNA replication along the leading and lagging…
A: Replication is the process by which DNA duplicate and make its own copies, replication of DNA is a…
Q: Match the letters with the enzyymes and macromolecules invoived DNA replication: A B INCOMING…
A: There are number of processes necessary for the continuation of generation , growth and…
Q: Draw a diagram of a single replication fork. Label the following on your diagram: 1. All 3’-OH ends…
A: DNA replication employs an outsized range of structural proteins and enzymes, each of that plays an…
Q: pol III moves 5 pol I replaces primer A with DNA pol I binds to 5 end of primer A DNA ligase links…
A: DNA replication is the biological process of producing two identical replicas of DNA from one…
Q: 5' 3' For numbers 6 to 10, refer to the image above and answer the questions. 6. Which among the two…
A: During DNA replication, the double stranded DNA molecules are separated into single strands and…
Q: A cytosine deamination occurs in the top strand of the following DNA duplex 5'-gATTACA-3'…
A: DNA (deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…
Q: The image below shows the replication bubble of a piece of DNA in the process of replication.…
A: DNA replication is the process to make copies of DNA. The new DNA strands are always synthesized…
Q: When DNA replication was investigated by using heavy, N15 DNA to mark the original molecules, and…
A: DNA replication of phenomenon of formation of new strand of DNA . There are several model of DNA…
Q: Okazaki fragments are small pieces of DNA synthesized discontinuously on the lagging strand of DNA…
A: Introduction: DNA replication is semi-conservative. The double helix's individual strands serve as…
Q: Label the following diagram using the words from the word box below. You can write your answers in…
A: As per our company guideline we are supposed to answer only first question or first 3 subparts of…
Q: Which of the following is not a true statement comparing prokaryotic and eukaryotic DNA replication?…
A: BASIC INFORMATION CELL It is considered as the basic unit of life Every organism is made up of…
Q: Below is a figure representing DNA replication. One end of the DNA is labeled; given this…
A: * DNA replication is a process in which double stranded DNA molecule is copied and hence produce…
Q: Number the steps of DNA replication in the correct order (1, 2, 3) a) ______ Polymerase travels down…
A: Correct order is 1.)- b. 2.)-a. 3.)-c
Q: In the following diagram of DNA replication fork, A is a subunit of DNA polymerase Ill. O b. y…
A: DNA polymerase III is used in the synthesis of Chromosomal DNA. DNA pol III participates in the DNA…
Q: 1 2 3 4 5 6 7 8 9 The gaps between the DNA fragments are sealed by DNA ligase…
A: The DNA replication starts with the opening of two strands and then DNA polymerase binds elongates…
Q: A gene encoding one of the proteins involved in dna replication has been inactivated by a mutation…
A: DNA replication adopts a semi - conservative pattern. Each of double helix's strands serves as a…
Q: 14
A: DNA replication is a process in which a single DNA molecule under goes replication and produces two…
Q: Match the items on the diagram with the correct term below. 3' 5' 5 D 8 Activate W DNA Replication…
A: DNA replication is the procedure through which cells make copies of the DNA. A cell must first copy…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps with 1 images
- You are studying a new virus with a DNA genome of 12 Kb. It can synthesize DNA at a rate of 400 nucleotides per second. If the virus uses rolling-circle replication, how long will it take to replicate its genome? Answer only for the first strand; ignore replication along the displaced strand. O 7.5 seconds O 15 seconds O 30 seconds O 1 minute O 2 minutesDraw a diagram of a single replication fork. Label the following on your diagram: 1. All 3’-OH ends 2. All 5’-phosphate ends 3. leading strand (s) 4. lagging strand (s) 5. Okazaki fragments (draw 3) ❏ RNA primer(s) 6. direction of replication ❏ replisome(s) 7. origin (s) 8. terminus (i)Which of the following is not depicted in the diagram attached? A. Okazaki fragment B. Replication fork C. Leading strand D. Origin of replication
- Why does the DNA replication happen in the 5`-3` direction instead of the 3`-5`, what would happen if it didnt replicate from 5-3 directionIn the following drawing, the top strand is the template DNA, andthe bottom strand shows the lagging strand prior to the action ofDNA polymerase I. The lagging strand contains three Okazakifragments. The RNA primers, which are shown in red, have not yetbeen removed. A. Which Okazaki fragment was made first, the one on the left orthe one on the right?B. Which RNA primer will be the first one to be removed by DNApolymerase I, the primer on the left or the primer on the right?For this primer to be removed by DNA polymerase I and for thegap to be filled in, is it necessary for the Okazaki fragment inthe middle to have already been synthesized? Explain.C. Let’s consider how DNA ligase connects the left Okazaki fragmentwith the middle Okazaki fragment. After DNA polymerase Iremoves the middle RNA primer and fills in the gap with DNA,where does DNA ligase function? See the arrows on either sideof the middle RNA primer. Is ligase needed at the left arrow, atthe right arrow, or both?D. When…E. coli cells grown on 15N medium are transferred to 14N mediumand allowed to grow for two more generations (two rounds ofDNA replication). DNA extracted from these cells is centrifuged.What density distribution of DNA would you expect in thisexperiment?(A) one high-density and one low-density band(B) one intermediate-density band(C) one high-density and one intermediate-density band(D) one low-density and one intermediate-density band
- What proteins are crucial for creating and maintaining DNA replication forks? Choose the best explanation. Question 2 options: Helicase creates the replication fork; primase keeps the single strands from closing shut. Helicase creates the replication fork; single-strand binding proteins keep the single strands from reuniting. Ligase creates the replication fork; DNA polymerase II keeps the single strands from reuniting. Helicase creates the replication fork; ligase keeps the single strands from closing shut.Which statement below best describes what these data might have demonstrated to Kornberg about the process of replication? CHOOSE ONE and explain the rationale behind your answer in a minimum of four sentences. A. Products of replication are DNA polymers. B. DNA Pol I-mediated replication is a high-fidelity (i.e., no mistakes) process C. DNA Pol III-mediated replication gives rise to two daughter strands, one which is made of only the original templates, and one of which is only newly synthesized polymer. D. In DNA, all 4 classes of nitrogenous bases are more or less equally represented E. A pairs with T and C pairs with GThe above experiment, on DNA synthesis in the intact chromosomes of E. coli (with no virus infection), demonstrates which of the following forms of DNA replication? completely discontinuous replication completely conservative replication completely dispersive replication semi-discontinuous replication semi-conservative replication
- Using 14N isotope medium for DNA replication instead of 15N, what would be observed ifDNA replication were conservative in one cycle of replication/in three cycles? How aboutdispersive replication in one cycle, in three cycles?The sequence below shows the ends of one strand of a linear chromosome, with slashes representing the middle part, which is not shown. During replication of this one strand, on which side of the slashes will Okazaki fragments be made in the newly synthesized strand? 5' AGCCGTACGGTTATCTCCTAG //// GGGCCTATTGTGACCAGTGAGTCG 3' a) Both sides b) Neither side c) The right side d) The left sideAfter the students identified the correct model, they did additional research on how DNADNA is replicated. The students then returned to the models that they drew and made the following claims. Student 1: The model does not need to be changed because DNADNA replication can occur without proteins.Student 2: Proteins need to be added to the model. Without proteins, DNADNA replication would not be possible. Which of the following statements indicates the correct student claim and provides the appropriate reasoning?