After the entire coding sequence of a protein has been decoded and the peptide chain is synthesized, it needs to be released from the final tRNA in the P site of the ribosome so it can float away from the ribosome to do its thing. Which of the following allows release of the peptide? If no new aa-tRNAS can bind the codon near the A site, then eventually the peptidyltransferase site in the ribosome will function in reverse and cleave the bond between the peptide chain and the TRNA O A protein release factor enters the A site and base pairs with the stop codon when it is near the A site - this protein positions a water molecule and helps promote a hydrolysis reaction that releases the peptide chain from the tRNA O A leprechaun is attracted to the stop codon when it is near A site, and it pours Guinness on the bond between the peptide and the tRNA, which cleaves the bond O The 305 and 505 subunits disassociate as soon at the stop codon enters the 305 subunit- then the peptide-tRNA float out of the 505 subunit and are cleaved by an amino-acyl transferase

After the entire coding sequence of a protein has been decoded and the peptide chain is synthesized, it needs to be released from the final tRNA in the P site of the ribosome so it can float away from the ribosome to do its thing. Which of the following allows release of the peptide? If no new aa-tRNAS can bind the codon near the A site, then eventually the peptidyltransferase site in the ribosome will function in reverse and cleave the bond between the peptide chain and the TRNA O A protein release factor enters the A site and base pairs with the stop codon when it is near the A site - this protein positions a water molecule and helps promote a hydrolysis reaction that releases the peptide chain from the tRNA O A leprechaun is attracted to the stop codon when it is near A site, and it pours Guinness on the bond between the peptide and the tRNA, which cleaves the bond O The 305 and 505 subunits disassociate as soon at the stop codon enters the 305 subunit- then the peptide-tRNA float out of the 505 subunit and are cleaved by an amino-acyl transferase

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 17QP: Given the following mRNA, write the double-stranded DNA segment that served as the template....

See similar textbooks

Similar questions

Pre-mRNAs in mitochondria are converted to maturemRNAs through ______editing, which makes translation ofthe transcripts possible
Describe the recognition process by whichthe tRNA for N-formylmethionine interacts with the portion ofmRNA that specifies the start of transcription.
You are observing the translation process in a eukaryotic cell that has been exposed to an unknown toxin. About halfway through synthesizing the protein, you note that elongation is stalled. Upon closer observation you notice the polypeptide is attached to the tRNA in the A-site, while the P site is occupied by an uncharged tRNA. A possible mechanism that is inhibiting translation is: Question 21 options: eEF-1βγ (beta-gamma) was inhibited from activating eEF-2. Peptidyltransferase activity was inhibited. eEF-2 was inhibited from being activated. eEF-1βγ (beta-gamma) was inhibited from activating eEF-1α (alpha). eEF-1α cannot be released from the aminoacyl-tRNA in the A-site.
Which statement is false: A) Each type of protein ( ex: hemoglobin vs trypsionngen) varies in the length and amino acid sequence of its peptide B) After the rpocess of transcription is complete, the mRNA that is produced will continue being tranlsated by ribosomes for the rest of the cells life. mRNA never breaks down C) A ribosome will bind to an mRNA and will translate the sequence by reading one codon at a time and adding one amino acid to the peptide chain. It will stop the translation once it encounters a stop codon D) The gene for a protein provides the information on the legth of the peptide, along w the amino acid sequence so the protein can be synthesized by a ribosome E) Once mRNA has left the nucleus, ribosomes will bind to it and will follow the instructions in its sequence to make the new protien
Following is the sequence of a segment of mRNA: CGA AAA GUU UUU What are the anticodons of the tRNAs that will be used for translating this mRNA segment? Group of answer choices a. CGA, AAA, GUU, and UUU b. ARG, LYS, VAL, and PHE c. GCU, UUU, CAA, and AAA d. Arg-Lys-Val-Phe e. GCT, TTT, CAA, and AAA
Do the following events during bacterial translation occur primarily within the 30S subunit, within the 50S subunit, or at the interface between these two ribosomal subunits? A. mRNA-tRNA recognition B. Peptidyl transfer reaction C. Exit of the polypeptide from the ribosome D. Binding of initiation factors IF1, IF2, and IF3
The following DNA nucleotides are found near the end of a bacterial transcription unit. 3′–AGCATACAGCAGACCGTTGGTCTGAAAAAAGCATACA–5′ Q. Draw a diagram of the RNA that will be transcribed from this DNA, including its nucleotide sequence and any secondary structures that form.
Usually found in prokaryotes, regulatory sequences lying adjacent to the DNA being transcribed are composed of a promoter located next to a(n) ____ that interacts and is controlled by regulatory protein. TATA box rho binding domain RNA polymerase holoenzyme operator
Formation of the 70S ribosomal initiation complex for prokaryotic translation requires: a.tRNAfMet b.tRNAMet c.GTP d.EF-Tu e.IF-2 f.Mn2+
Which of the following best describes a sequence of events that happens during the elongation phase of translation? Group of answer choices A charged tRNA enters the P site of a ribosome; a tRNA bound to a peptide moves to the A site; an tRNA bound to a peptide exits the E site. None of these is an accurate description A charged tRNA enters the A site of a ribosome; a tRNA bound to a peptide moves to the P site; an uncharged tRNA exits the E site. An uncharged tRNA enters the A site of a ribosome; a tRNA bound to a peptide moves to the P site; a charged tRNA exits the E site. A charged tRNA enters the A site of a ribosome; a tRNA bound to a peptide moves to the E site; an tRNA bound to a peptide exits the A site.
Protein X is a soluble, secreted protein. It has an N-terminal ER import sequence that allows it to be translocated into the ER during translation. If you altered the sequence of this protein in the following ways, would it affect its final destination? If yes, explain why and what the new destination would be. If not, explain why. 1) You add an ER retention signal to the protein. 2) You add a nuclear localization signal to the end of the protein sequence.
. You have identified a mutation in yeast, a unicellular eukaryote, that prevents the capping of the 5′ end of theRNA transcript. However, much to your surprise, all theenzymes required for capping are normal. You determine that the mutation is, instead, in one of the subunitsof RNA polymerase II. Which subunit is mutant, andhow does this mutation result in failure to add a cap toyeast RNA?