A mutation produces a tRNA with a new anticodon. Originally the anticodon was 5'-CCA-3'; the mutant anticodon is 5'-UCA-3'. What effect will this mutant tRNA have on cellular translation?
Q: Cycle of tricarboxylic acids (TCA): • importance for cellular metabolism; • intracellular…
A: It is a step wise cyclic but complete oxidation and decarboxylation of of active acetate group to…
Q: Briefly explain the Warburg Effect. How can the Warburg effect be taken advantage
A: INTRODUCTION : Glycolysis : It is a metabolic pathway of the cells of body,in which Glucose is…
Q: The activity of an enzyme can be regulated by a: A) competitive inhibitor binding to the active…
A: The enzymes increase the rate of biochemical reactions and can be regulated by binding to…
Q: The main stages of catabolism of biomolecules: proteins, carbohydrates and lipids.
A: Catabolism is one is the steps of metabolism in which complex compounds are hydrolysed into simpler…
Q: Discuss the role of carbohydrates on cancer and suggest an appropriate treatment
A: Carbohydrates are biomolecules, which are the primary source of energy for the body. All of the…
Q: Based on what you know about what powers ATP synthesis and how NADH and FADH2 interact with various…
A: Introduction Cellular respiration is a process by which glucose molecule breaks and produce carbon…
Q: What volume of a 0.8 M glucose solution can be made from 50 mL of a 2M stock solution?
A: Stock solution is the given solution present in lab. From the stock solution, we make the working…
Q: 384 Hemoglobin: Allostery and Evolution Q5.1 - 2,3-BPG is a negative allosteric regulator of…
A: Hemoglobin (Hb) is a protein that is found in red blood cells. A specific protein called haemoglobin…
Q: 3. Briefly describe and explain the shape of the curve in Q2.
A: In an enzyme-catalysed reaction, the substrate binds reversibly to the enzyme's active site to form…
Q: 1. Inulin is a polysaccharide composed of entirely fructose units. Which test should be used to best…
A: Introduction : Inulin - Inulin is a type of naturally occuring polysaccharide which is produced by…
Q: Describe the mechanism of feedback inhibition and the role this process plays in controlling enzyme…
A: The process of enzyme inhibition that is induced by the end product of a reaction to prevent the…
Q: Which is the strongest non-covalent interaction that occurs between triglycerides: hydrogen bonds,…
A: - A non-covalent bond is one in which there is no sharing of electron pairs. It mainly occurs…
Q: ĭ HO O-C-R' O=O=O=O -O-C-R" -O-C-R"" A -P=00=0 HII -N-C-R" OH E O-sugar O || -0-C-R" -NH3+ -(CH₂)12…
A: Lipids are a chemically diverse group of biomolecules that have two things in common: low…
Q: Disruption of which process will have the greatest impact on the number of electron carriers used by…
A: Disruption of which process will have the greatest impact on the number of electron carriers used by…
Q: Analyze each item carefully and write your complete solution. Cysteine is an important amino acid…
A: Note: As per the honor code we are allowed to answer the first two questions. Kindly resubmit the…
Q: 1. DNA: ATACGAAATCGCGATCGCGGCGATTCGG mRNA: Codon: Anticodon: Amino Acids: 2. DNA:…
A: During the process of transcription, one strand of the DNA act as the template for the synthesis of…
Q: 16. If the aerobic catabolism of 1 mol of glucose yields 38 mol of ATP, and the energy released by…
A: "Since you have asked multiple questions, we will solve the first question for you. If you want a…
Q: What is binding energy? What do negative and less negative energies represent? How does this relate…
A: Binding energy is the amount of energy required to separate a system into its constituents. If we…
Q: Question 15 of 25 Which of the following is true for the acid-base properties of amino acids? Select…
A: The proteins are made of 20 naturally occurring amino acids. The net charge on the side chain of the…
Q: If we were handed a tube of 2mg/mL BSA how much is required 20μL of each of the following…
A: Different concentrations of protein solutions are needed to be prepared during biochemical…
Q: INFLUENCE OF FREE ACID tt #1 tt #2 tt #3 tt #4 CONDITION 4 mL 0.2% HCI + 1 mL starch paste + 1 drop…
A: Effect of saliva on starch: Saliva contains the digesting enzyme amylase, which breaks down starch.…
Q: Given the following reaction and equation for the initial velocity of the reaction: k₁ k3 E+SES E +…
A: We are given two equations for initial velocity (V). V=kcat [ES] -------(eq1) andV=k3 [ES]…
Q: For each of the structures listed below identify the class of lipids to which it belongs (fatty acid…
A: Lipids are biomolecules that do not have a fixed chemical structure like carbohydrates or amino…
Q: What are the major functions of carbohydrates? Which functional group in a monosaccharide causes it…
A: Chemically, carbohydrates are polyhydroxy aldehydes or ketones. They have the general formula :…
Q: What is the charge on the following peptide at standard biochemical pH? S-Y-D-F-K-I-V-F-L-L +2 -1 O…
A: Peptides are composed of amino acids. Amino acids are biomolecules with an alpha carbon bonded to an…
Q: Which of the following statements is CORRECT? A) Hexokinase IV is allosterically inhibited by…
A: Enzyme plays an important role in all the metabolic activities in our body. They themselves remain…
Q: 385 What acts as a reductant in the glutamate synthase reaction to catalyze the transfer of the…
A: Reductant is a substance that donates electrons to another substance and reduce it. In an…
Q: The diagram to the right illustrates the inter-actions of the amino acid side chains of two…
A: Coiled coils are super secondary structures formed as 2 or more alpha helices twist around each…
Q: In ATP synthase, the ____ subunit is the site of ATP synthesis while the ____ subunit forms the…
A: Oxidation of glucose in the glycolysis and TCA cycle generates electrons carriers NADH and FADH2, As…
Q: RNA polymerase is found in the mitochondrial matrix. True False
A: The "powerhouses" of the cell are frequently referred to as mitochondria. They assist in converting…
Q: The mitochondrial matrix is home for the following: I. ribosomes II. circular DNA III. Kreb's…
A: Mitochondria is a membrane bound organelle which is also known as power house of the cell as it is…
Q: Which of the following is correctly classified? O Arachidic (20:0) is a medium chain unsaturated…
A: Fatty acids are carboxylic acids with a hydrocarbon chain ranging from 4 carbon to 36 carbons. The…
Q: What is acid-base homeostasis?
A: Homeostasis is the ability of an organism to regulate its internal environment in varying external…
Q: Mach column (A) with Column (B)?* Waxes Serous gland Sphingolipids Fatty acid Beta oxidation Ketone…
A: Lipids are classified into three groups as simple lipids, compound lipids, and derived lipids based…
Q: Fumerase is an enzyme in the citric acid cycle that catalyzes the conversion of fumerate to…
A: Parameters such as Km and Vmax are used for comparing enzyme activities. If we know the initial rate…
Q: The value of kcat for N-Ac-Phe-OC₂H5 is two-fold greater than that for the L-tryptophanyl analog and…
A: Chymotrypsin catalyzed peptide bond hydrolysis takes place in 2 phases after the enzyme binds the…
Q: 1. Why do proteins become polycations at extremely low pH and become polyanions at very high pH? 2.…
A: Proteins are biological macromolecules formed by monomers of amino acids. The amino acids have side…
Q: The second high energy intermediate metabolite of glycolysis that can be used for substrate level…
A: Glycolysis is the biochemical pathway by which six-carbon glucose is converted to three-carbon…
Q: How can an understanding of enzymes and biological receptors guide medicinal chemists? Match the…
A: It was long recognized as a differentiating feature of both drug and receptor, the selectivity of…
Q: The AG of the reaction C6H12O6 +602 --> 6CO2 + 6H₂O is -686 kcal/mol glucose The oxidation of…
A: For biological systems, free energy (G), enthalpy (H) and entropy (S) are related as : ∆G = ∆H - T∆S…
Q: 5. н., с Н-С-ОН H-C-OH H -C-OH I CH2OH Chemical formula Carbohydrate?
A: Carbohydrates are molecules containing the elements Carbon, Hydrogen and Oxygen which generally have…
Q: 3. DNA: TACGGGCCTATACGCTACTAC TCATGGATCGG mRNA: Codon: Anitcodon: Amino Acids:
A: The flow of genetic information from DNA to RNA, RNA to protein synthesis is called central dogma.…
Q: Chemical biologists view metabolism's citric acid cycle as its fulcrum. The enzyme isocitrate…
A: Citric acid cycle: (Krebs cycle) Citric acid, a tricarboxylic acid that is frequently referred to…
Q: 3. Use the structure shown below to answer the questions that follow: a b C. bottom. CH₂OH OH ) Name…
A: Carbohydrates are the important bio molecules that provide energy for the living organisms.…
Q: Question 9 of 25 Among the given organelles, which ones are present in animal cells but not in plant…
A: Prokaryotes are organisms without a nuclear envelop while eukaryotes are organisms which possess an…
Q: 1. Under what circumstances in the cell would the entire pentose phosphate pathway be carried out…
A: The pentose phosphate pathway is also called HMP shunt pathway. It branches from glucose 6-phosphate…
Q: Imagine a disease that involves reduced expression of receptor X. There is no concentration of full…
A: In receptor-ligand interaction, the receptor is a macromolecule that serves as the binding site of…
Q: molecule with a hydrophilic end and a hydrophobic end
A: Molecules with a hydrophobic and hydrophilic end are known as amphipathic molecules. Such molecules…
Q: Given the following reaction below, what amino acid is involved and what is the specific reaction…
A: Phenylalanine, tyrosine, and tryptophan are aromatic amino acids. The side chain of the…
Q: AMP is an activator of fructose 1,6-bisphosphatase (FBPase-1) True False
A: Glycolysis is the process by which one molecule of 6 carbon glucose is broken down into 2 molecules…
Step by step
Solved in 2 steps with 1 images
- Exploring the Structure of the 30S Ribosomal Subunit Go to www.pdh.org and bring up PDB file 1GIX, which shows the 30S ribosomal subunit, the three tRNAs, and mRNA. In the box on the right titled ‘Biological Assembly.â€� click “More Images.â€� and then scroll down to look at the Interactive Vic By moving your cursor over the image, you can rotate it to view it from any perspective. a. How are the ribosomal proteins represented in the image? b. How is the 16S rRNA portrayed? c. Rotate the image to see how the tRNAs stick out from the structure. Which end of the tRNA is sticking out? d. Where will these ends of the tRNAs lie when the 50S subunit binds to this complex?3. (i) Referring to the genetic code (the codon usage table), what would be the amino acidsequence of the polypeptide encoded by the following mRNA sequence?5’ AUGGUGGCCUAUCAUUAGGGGCUU 3’(ii) What would be the effect on translation of the above sequence of a single base (point)mutation which gave rise to an A instead of a U at the twelfth base?(iii) What would be the effect on translation of the sequence in (i) above, if an extra Cwere inserted between the third and fourth bases, i.e., between the two Gs at position 3and 4?The coding (or “sense”)strand(again noticename ANDthe directionality)of DNAthat is known to encode the C-terminal end of a long E. coliprotein has the following nucleotide sequence:5′–CCATGCAAAGTAATAGGT–3′Give the sequence of the last three amino acids of the protein (label the C-terminus).
- Write the order of nucleotides in mRNA that would be transcribed from the following strand of DNA: GTATACCAGTCATTTGTCThen list in order the amino acids coded by this sequence.mRNA ________________________________________________________________amino acids ________________________________________________________________ 2. Sometimes a mistake occurs in the translation of an mRNA strand. Suppose that the reading of themRNA strand in question 1 began, by mistake, at the second nucleotide instead of the first. The first codonwould be AUA. Write the sequence of amino acids that would be formed.__________________________________________________________________________PLEASE FL OUT TABLE USING INSTRXUTIONS -USE BASE PAIRING RULES TO COMPLETE SECOND COLUMN FOR EACH MUTATION WRIYE IN ANY MRNA DOEONS RHAT WILL BE FHANGED AS THE REEULR OF RHE MURATION AND USE X MARKS RO INDÍCATE DOONS THAT WONT BE FHANGES CIRCLE STOP CODONSHello, I would really appiarte help appreciate help. This is a blank question so I am unsure why it was rejected immeditely the first time. Thank you in advance. Identify the type of mutation and how it would affect the protein made (amino acid) if the following changes occurred in the DNA antisense strand First codon change from TAC to TAT. Third codon change from ACG to ACA. Ninth nucleotide changes from G to T. Nucleotide with adenine (A) base inserted between 3rd and 4th nucleotide. Types of Mutation Changes in the Amino Acid 1. 2. 3. 4.
- DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ From the given DNA sequence above, change one base in codon 8 to show same sense mutation.Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:b. Identify the type of base pair substitution that you applied in codon 8 Add an A before codon 3 or delete the middle base in codon 3 to show the shift of reading frame to:a. the rightDNA:mRNA:polypeptide chain:b. the leftDNA:mRNA:polypeptide chain:SCIENTIFIC INQUIRY Knowing that the genetic code is almostuniversal, a scientist uses molecular biological methods toinsert the human β-globin gene (shown in Figure 17.12) intobacterial cells, hoping the cells will express it and synthesizefunctional β-globin protein. Instead, the protein produced isnonfunctional and is found to contain many fewer amino acidsthan does β-globin made by a eukaryotic cell. Explain why5' ACTGAGGATTCGGACAGCAATAGGATG 3' When translated, the -1 reading frame of the sequence above gives the following amino acid sequence: HPIAVRILS What triplet of nucleotides (in other words, what DNA codon) represents the amino acid "P" (proline)? a) 5' GTA 3' b) 5' CAT 3' c) 5' CCT 3' d) 5' ATC 3'
- 1- Biochemist Erwin Chargaff was the first to note that, in DNA, [A] = [T] and [G] = [C], equalities now called Chargaff’s rule. With the use of this rule, determine the percentages of all the bases in a DNA molecule which contains 35% thymine. Explain. 2- Similar equalities (i.e. [A]=[U] and [G]=[C]) are however not observed in RNA molecules. Explain the structural differences which dictate why Chargaff rule does not apply to RNA polynucleotides.1. Here is the amino acid sequence of part of a hypotheticalgene you want to clone:Pro-Arg-Tyr-Met-Cys-Trp-Ile-Leu-Met-Sera. What sequence of fi ve amino acids would give a 14-merprobe with the least degeneracy for probing a library tofi nd your gene of interest? Notice that you do not use thelast base in the fi fth codon because of its degeneracy.b. How many different 14-mers would you have to makein order to be sure that your probe matches thecorresponding sequence in your cloned gene perfectly?c. If you started your probe one amino acid to the left of theone you chose in (a), how many different 14-mers would youhave to make? Use the genetic code to determine degeneracy.a) Replicate this sense strand to create a double-stranded DNA helix TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT b) Using this DNA double helix, express the gene – i.e. determine the resulting polypeptide sequence by using the correct reading frame. When you get to the stop codon – you may write an asterisk (i.e. a “*”) to denote the stop codon. c) Does the sense strand DNA sequence have 5’ and 3’ UTR sequences? If so – write them in the space below 5’ UTR: 3’ UTR:
