codons is the term used to describe the genetic code because the rules that relate the nucleotide sequence in the mRNA to the amino acid is the same in most organisms. degenerate is the term used to describe the genetic code because codons do not overlap, and are not separated by spaces rebundancy is the term used to describe the genetic code because there is more than one codon that specify for an amino acid tryptophan is the term used to describe the genetic code because a codon specify only for one amino acid sense strand is the term used to describe the DNA because one strand runs 5' to 3' while the other strand runs 3' to 5' complement is the term used to describe the DNA because adenine is always paired with thymine while guanine is always paired with cytosine denaturation is the term that refers to the separation of the double stranded DNA

codons is the term used to describe the genetic code because the rules that relate the nucleotide sequence in the mRNA to the amino acid is the same in most organisms. degenerate is the term used to describe the genetic code because codons do not overlap, and are not separated by spaces rebundancy is the term used to describe the genetic code because there is more than one codon that specify for an amino acid tryptophan is the term used to describe the genetic code because a codon specify only for one amino acid sense strand is the term used to describe the DNA because one strand runs 5' to 3' while the other strand runs 3' to 5' complement is the term used to describe the DNA because adenine is always paired with thymine while guanine is always paired with cytosine denaturation is the term that refers to the separation of the double stranded DNA

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter13: Gene Expression

Section13.4: Translation

Problem 3C: A certain mRNA strand has the following nucleotide sequence: 5AUGACGUAUAACUUU3 What is the anticodon...

See similar textbooks

Similar questions

Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:
Eukaryotic mRNA: usessnRNPs to cut out introns and seal together translatableexons. uses a spliceosome mechanism made of DNA to recognizeconsensus sequences to cut and splice. has a guanine cap on its 39 end and a poly(A) tail on its 59 end. is composed of adenine, thymine, guanine, and cytosine. codes the guanine cap and poly(A) tail from the DNAtemplate.
A part of an mRNA molecule with the sequence 5-UGC GCA-3 is being translated by a ribosome. The following activated tRNA molecules are available. tRNA Anticodon Amino Acid 3-GGC-5 Proline 3-CGU-5 Alanine 3-UGC-5 Treonine 3-CCG-5 Glycine 3-ACG-5 Cysteine 3-CGC-5 Alanine Which two of them can bind correctly to the mRNA so that a dipeptide can form? a. cysteinealanine b. prolinecysteine c. glycinecysteine d. alaninealanine e. threonineglycine
In the gene-coding sequence shown here, which of the following events will produce a frameshift after the last mutational site? a. insertion of an A after the first codon b. deletion of the second codon (AAA) c. insertion of TA after the second codon and deletion of CG in the fourth codon d. deletion of AC in the third codon
The genetic code is defined as a series of _______________ in _______________. (a) anticodons; tRNA (b) codons; DNA (c) anticodons; mRNA (d) codons; mRNA (e) codons and anticodons; rRNA
What is the complementary DNA sequence to the following DNA sequence? ATGCCATCG ____________________________ Write the mRNA codon sequence for the following DNA sequence. CTGCACTGA ____________________________ Write the anticodon tRNA sequence for the following mRNA sequence. UACGACUAG ____________________________ Name the amino acids that use the following mRNA codons. CAU ______________________________ AUG ______________________________ AAG ______________________________ CCC ______________________________ Name the amino acids that use the following DNA codons TAT ______________________________ CGA ______________________________ List the amino acid sequence for the following mRNA code. Be sure that you start with the first start codon you get to and then proceed to list the amino acids until you get to a stop codon. CGUAUGACUGGAAUACUUUAGCCAGCU __________________________________________________________________
Which of the following statements about the genetic code are true and which are false? Correct each false statement. A.Each codon is composed of four bases. B.Some amino acids are represented by more than one carbon. C.All codons represent an amino acid. D.Each living species is thought to have its own unique genetic E.The codon AUG at the beginning of a sequence is a signal for protein synthesis to begin at that codon. F.It is not known if the code contains stop signals for protein synthesis.
Which choice best fits the blank? Refer to picture. The ribosome moves along the mRNA strand. In panels b, c, and d, new tRNAs carrying ___________. match up with the codons of the mRNA strand. After each tRNA locks into place, a peptide bond forms between the amino acid the tRNA is carrying and the amino acid already there. This process repeats until the end of the sequence is reached. A. ProteinsB. NucleotidesC. Amino Acids
Which of the following mRNA codons could be changed to a stop codon by a single base pair substitution in DNA ? [In other words, if you substitute one of the bases for a diferent one, it will produce a stop codon. Don't overthink this. Just look at the codon as written, and see if changing any one base leads to a stop codon]. 1. UAC (tyrosine) 2. UGG (tryptophan) 3. CGA (arginine) 4. ACU (threonine) A. 1, 2 and 3 B. 1 and 3 C. 2 and 4 D. 4 only E. All of 1, 2, 3 and 4 are correct
On the mRNA codon table below, the first nucleotide in mRNA is to the left, the second is above, and third is to the right. On the sequence, the 5’cap is indicated by (5’). The poly (A) tail is not shown. Use the codon table to translate this short mRNA. Mark the codons and write the amino acid sequence beneath them. (5’)CGUUACAAUGUAUCGCGCGGUACUCGGCAAAGUGCCCUGAAUAGAGUUGGUA(3’) In a previous round of replication, DNA polymerase made a mistake and added a C on what is now the DNA template strand. In the space on the mRNA sequence below, write the added base. Mark the codons again and write the amino acid sequence beneath them. What do you observe? (5’)CGUUACAAUGUAU CGCGCGGUACUCGGCAAAGUGCCCUGAAUAGAGUUGGUA 3’
The figure below shows a ribosome in the process of translating an mRNA with the sequence: 5’…AUGCCGUAUGCUCUUUAA…3’ a. The right side shows the ribosome with an empty A site aligned with the codon 5’UAU 3’. The next tRNA to occupy the A site on the ribosome will have what anti-codon sequence ( label 5’ and 3’)? Keep in mind the wobble pairing rules and make sure your answer is consistent with the genetic code. Explain your answer. b. Suppose, just as the ribosome started translating the mRNA, the cell suddenly lost all of its alanine tRNAs. Using the figure above as a guide, draw and label the state the ribosome would arrest in.
The figure below shows a ribosome in the process of translating an mRNA with the sequence: 5’…AUGCCGUAUGCUCUUUAA…3’ a. The right side shows the ribosome with an empty A site aligned with the codon 5’UAU 3’. The next tRNA to occupy the A site on the ribosome will have what anti-codon sequence ( label 5’ and 3’)? Keep in mind the wobble pairing rules and make sure your answer is consistent with the genetic code. Explain your answer.