Depict the RNA transcript in the box below 5' - ATG GGG CCC GTT TTC AAT ATG CAG GTC CAT CCG TAC GTA CAG GCC GGA ATT TGA - 3 DNAS' 3 DNA3 RNAS Question 3.2. Depict the mRNA transcript in the below RNAS MRNA5' Question 3.3. Translate the mRNA MRNAS Protein in in

Depict the RNA transcript in the box below 5' - ATG GGG CCC GTT TTC AAT ATG CAG GTC CAT CCG TAC GTA CAG GCC GGA ATT TGA - 3 DNAS' 3 DNA3 RNAS Question 3.2. Depict the mRNA transcript in the below RNAS MRNA5' Question 3.3. Translate the mRNA MRNAS Protein in in

Name: Remember remove the introns! All introns start with GT and end with AG
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Remember remove the introns! All introns start with GT and end with AG. Depict the RNA transcript in the box below5' - ATG GGG CCC GTT TTC AAT ATG CAG GTC CAT CCG TAC GTA CAG GCC GGA ATT TGA - 3'DNAS'3'DNA3'5'RNA5Question 3.2.Depict the MRNA transcri

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter30: Protein Synthesis

Section: Chapter Questions

Problem 20P

See similar textbooks

Similar questions

Translate the following mRNA transcript 5’CGCCGAUGCGCGAUAUGUGGUAA’3 A. RRCAICG B. ADARYVV C. MRDMW-
Coding DNA 5’- GTG ACT CGT TGT GCC ATT GCA GCT AAA CAC TTC GAG CCC TGT- 3’ mRNA 5’- GUG ACU CGU UGU GCC AUU GCA GCU AAA CAC UUC GAG CCC UGU- 3’ What is the polypeptide sequence?
The following is a portion of an mRNA sequence: 3’ –AUCGUCAUGCAGA-5’ a)During transcription, was the adenine at the left-hand side of the sequence the first or the last nucleotide used to build the portion of the mRNA shown? Explain how you know. b)Write out the sequence and polarity of the DNA duplex that encodes this mRNA segment. Label the template and coding DNA strands. c)Identify the direction in which the promoter region for this gene will be located.
Choose correct option and do explain plz. 1. The protein complex that helps RNA polymerase to cross nucleosomes during extension is:a. SWI-SNFb. poly A polymerasac. TFIISd. FACT 2. The polydenylation is carried out by:a. primaseb. polymers poly ac. a reverse transcriptased. adenylyltransferase 3. The lactose operon produces a polycistronic mRNA that includes four genes: Lacl, LacZ, LacY and LacA. True or false?
Below is the DNA sequence of a patient with overlapping genes (a single mRNA has multiple initiation points for translation) for two different proteins (DADαs and AMA): 5’- GTCCCAACCATGCCCACCGATCTTCCGCCTGCTTCTGAAGATGCGGGCCCAGGGAAATCTCTAACG-3’ 1. Indicate the DNA sequence coding for RNA. 2. Indicate the amino acid sequence of each of them.
The following diagram represents a transcription unit in a hypothetical DNA molecule. 5′ … TTGACA … TATAAT … 3′ 3′ … AACTGT … ATATTA … 5′ a. On the basis of the information given, is this DNA from a bacterium or from a eukaryotic organism? b. If this DNA molecule is transcribed, which strand will be the template strand and which will be the nontemplate strand? c. Where, approximately, will the transcription start site be?
Consider the following mRNA base sequence 5' CUU CAG 3 a What dipeptide is coded for this mRNA? b. What dipeptide is formed if a point mutation converts CUU to CUC? c. What dipeptide is formed it a point mutation converts CAG to AAG?
The following DNA nucleotides are found near the end of a bacterial transcription unit. 3′–AGCATACAGCAGACCGTTGGTCTGAAAAAAGCATACA–5′ a. Mark the point at which transcription will terminate. b. Is this terminator rho independent or rho dependent? c. Draw a diagram of the RNA that will be transcribed from this DNA, including its nucleotide sequence and any secondary structures that form.
A single nucleotide addition and a single nucleotide deletion approximately 15 bases apart in the DNA cause aprotein change in sequence fromPhe–Ser–Pro–Arg–Leu–Asn–Ala–Val–LystoPhe–Val–His–Ala–Leu–Met–Ala–Val–Lysa. What are the old and new mRNA nucleotide sequences? (Use the codon dictionary in Figure 9-5.)b. Which nucleotide has been added? Which has beendeleted?
⦁ Following is an mRNA sequence reported in data base.5’ ACC AGA ATG ACC ATG GCA 3’ 1 ⦁ If there are multiple possible start codons, how can you identify the original start codon? Explain.Your Answer: 2. 5’ ACC AGA ATG ACC ATG GCA 3’ This is an mRNA sequence, but why there are T’s instead of U’s? Explain.Your Answer:
⦁ Following is an mRNA sequence reported in data base.5’ ACC AGA ATG ACC ATG GCA 3’ ⦁ There are two ATG’s. From which the translation can be initiated.⦁ 1st ATG⦁ 2nd ATG⦁ None⦁ If there are multiple possible start codons, how can you identify the original start codon? Explain.Your Answer: ⦁ This is an mRNA sequence, but why there are T’s instead of U’s? Explain.Your Answer:
Consider a stretch of DNA (a hypothetical gene) that has the sequence 5’ ATG-CTA-TCA-TGG-TTC-TAA 3’ A) Transcribe and translate this gene using the genetic code table. Be sure to label the mRNA 3’ and 5’ ends. Write the amino acid sequence using 1 letter abbreviations. B) Now, our hypothetical gene has undergone a mutation. The mutant sequence is....3’ TAC-GAT-AGT-ACC-AAT-ATT 5’5’ ATG-CTA-TCA-TGG-TTA-TAA 3’ Transcribe and translate the mutant sequence. Be sure to label the mRNA 3’ and 5’ ends. Write the amino acid sequence using 1 letter abbreviations. C) Indicate the type of mutation (nonsense, missense, silent, or frame shift) present. D) How severe of a consequence will this mutation likely be in terms of protein function (none, mild, moderate or severe)? Why?