Antibodies play a critical role in the prevention of infection by the specific viruses the antibody is designed to detect. Which immune system cell produces antibodies? Indicate four ways that antibodies can disrupt the ability of a virus to infect a cell.

Q: List the anatomical pathway the water molecule takes from the left biceps femoris until it is…

A:

Q: Giardia lamblia enters a human or other host in what form? O a) trophozoite Ob) spore O c) endospore…

A: Protozoans are group of organisms that possess single cell and are eukaryotic . They are classified…

Q: What kinds of molecules the cell membrane witho transport proteins? O Large and hydrophobic= O Small…

A: Cell membranes act as barriers and gatekeepers. Cell membrane is semi-permeable .Cell membrane…

Q: 11. What is the value or r between individuals A and B? 12. What is the value or r between…

A:

Q: If the tobacco plant parents are both heterozygous for color, what are the possible genotypes and…

A: INTRODUCTION Phenotype : physical appearance of an organism. Genotype : Genetic makeup of an…

Q: After several rounds of replication, if COVID19 RNA changes from  5’ GGGUACAUGGUAGCCCCCGUCGAG …. 3’…

A: Mutations are sudden heritable changes in the genetic makeup of the cells which lead to altered…

Q: Knowing that a patient with chronic heart failure is using digoxin (digitalis) for more than 1 year,…

A: Digoxin is a medication that is commonly used to treat a variety of different heart conditions, such…

Q: A principle of biology is that biology affects our society. What is the value of increased…

A: INTRODUCTION Biodiversity, also known as biological diversity, refers to the variety of life present…

Q: The embryo of monocotyledonous seed consists of one large, shield shaped cotyledon. What is it known…

A: Seed: A seed is an embryonic plant with a protective coating around it. Seed development is a phase…

Q: Both statements are false. I. Adding acetyl groups in the histone tail restricts access to genes.…

A: Introduction:- Histones: In chromosomes, there is a type of protein called chromosomal protein.…

Q: 4. What is the effect of the amount of time spent on social media on a person’s anxiety level?…

A: As we know that anxiety is one of the mental disorder and symptoms of anxiety are sweating , panic ,…

Q: Identify three characteristics used to classify viruses.

A:

Q: Differential lengths of poly-A tails affect mRNA stability. Pre-transcriptional control…

A: According to bartleby guidelines only first question is to be answered. So upload other questions…

Q: A) Most ligers (offspring of a male lion and a tigress) and tigons (offspring of a male tiger and a…

A: Reproductive isolation mechanism The mechanisms are a set of evolutionary mechanisms, behavioral,…

Q: А D

A: Bones joins to form skeleton of body.  Bones made from osteocytes cells, calcium & phosphates.

Q: Which is NOT a characteristic of mitochondria? They: A) have two membranes. B) are the site of…

A: Organelles are the specialized structures that perform various jobs inside the cells. The term…

Q: These types of proteins come from foods that contain all amino acids for nitrogen balance and tissue…

A: Introduction A protein is a naturally occurring, extremely complex substance and does most of the…

Q: Almost all of the known species of the taxa Archea have been identified through cultivation in a…

A: The culturable as well as organisms of archae that are well investigated belongs to the species of…

Q: Select the FOUR characteristics of blological membranes 2 Integral proteins are firmly associated…

A: * A biological membran is an Selectively permeable membrane which separates the cell from external…

Q: Whar are the Microscopic (Organized and Unorganized) Urine Sediments which are significant…

A: The sediments found in the urine causes urinary tract infection. The type of the sediment helps us…

Q: Tropomyosin, at 93 kd, sediments at 2.6S, whereasthe 65-kd protein, hemoglobin, sediments at 4.3S.…

A: Introduction Tropomyosin is a 40-nanometer long rod-shaped molecule. Along the actin filaments, two…

Q: List the four distinguishing chordate traits.

A: Chordate contains two classes of invertebrates and one class of vertebrate. Invertebrates include…

Q: You have a mouse model that is a homozygous knockout mutant for the prnp gene (Prnp protein is not…

A: knockout mouse is a genetically engineered laboratory mouse (Mus musculus) in which a specific gene…

Q: Once in human cells, which of the following statements might best describe how COVID19 replicates?…

A: Coronaviruses make full-length copies of their genomic RNA, which are integrated into freshly formed…

Q: differential lengths of poly-A tails affect mRNA stability identify which describes the statement…

A: mRNA needs to undergo certain modifications in order for it to be active for translation process.…

Q: Select all that are true regarding the rhizosphere and rhizobacteria.   a. the rhizosphere is the…

A: Introduction  An ecosystem deals with both biotic and abiotic factors and their interaction with…

Q: Macrophages engulf bacteria through which process? O Phagocytosis O Pinocytosis O Receptor-mediated…

A: Phagocytosis is cell eating. Pinocytosis is cell drinking.

Q: ос О А Ов No answer text provided.

A: Several post-translational changes of nucleosomal histones' amino-terminal tails can impact…

Q: 4. What will be the effect on the clearing agent if the tissue is incompletely dehydrated? 5. Give…

A: Introduction Tissue is a group of cells that have similar structure and that function together as a…

Q: Scientific name Regular/Irregular Hydrangea macrophylla   Callistemon citrinus   Daucus carota…

A: Binomial Nomenclature is a generally utilized, formal process for naming an animal species. The…

Q: In fruit flies, gray body (G) is dominant to black body (g).  If a male with a black body mates with…

A: A trait is a characteristic features that is unique to particular individual . A monohybrid cross is…

Q: Give a brief description of a typical eukaryotic cell cycle, indicate during which phase DNA…

A: * cell cycle consists of four phases . They are  G1 phase  S phase G2 phase  M phase * During G1…

Q: 4 Describe the Fluid Mosaic Model of the plasma membrane.

A: Introduction :- S.J. Singer and Garth L. Nicolson proposed the fluid mosaic model. This model…

Q: Discuss the operation of Na+ - K+ pump in further detail (2 pages including a few figures, if…

A: * The sodium potassium pump can be found in many cell plasma membranes which can be Powered by ATP…

Q: Please answer the following 35 MCQS Pinocytosis is cell eating cell drinking cell lysis O cell…

A: Introduction :- Pinocytosis is a cell's process of ingesting fluids as well as dissolved small…

Q: The inhibition that make permanent damage to an enzyme is called: O Noncompetitive O Competitive O…

A: The enzymes are biocatalysts. These work as biochemical catalysts and catalyze different reactions…

Q: What are the structural components of a virus?

A: A virus is a non-cellular organism with an RNA or DNA genome encased in a virus-coded protein coat.…

Q: Classical evolutionary theory assumed that changeleads to improvement. T or F

A: This statement is indeed true since the earlier evolutionary scientists believed that change is what…

Q: When a prokaryote cell is placed in a hypertonic solution (water with a higher energy level compared…

A: Introduction :- Bacteria and archaea are examples of prokaryotic cells. Their genetic material is…

Q: 18. Which of the following entities has the largest interaction cross-section (most likely to…

A: Tissues are group of cells having similar function and structure.

Q: Put the following steps for the outline of the growth factor signaling pathway in order: Map Kinase…

A: Activities with constant changes in the environment. In doing so, organisms use a number of pathways…

Q: In control of ventilation, which of the following is the most important?   PCO2 in the blood PO2 in…

A: The physiological systems involved in controlling breathing, or the passage of air into and out of…

Q: Plant anatomy

A: The embryo develops at the micropylar end of the embryo sac where the zygote is situated. Most…

Q: Both statements are false. I. In Arabidopsis thaliana, cytosine demethylation within the Superman…

A: SUPERMAN gene involved in the formation of boundary between stamen and carpel in flower.  If…

Q: When the concentration of the hormone insulin is too high for an extended period: O The number of…

A: Insulin is defined as a peptide hormone which is generated by pancreatic islets of Langerhans cells…

Q: Name at least four reasons that people have created parksand reserves. How do national parks differ…

A: A national park is an area of land protected by the government for the public to enjoy. National…

Q: the cytoplasmic membrane is universally similar across the three Domains of life. Discuss this…

A: The cell membrane (also known as the plasma membrane (PM) or cytoplasmic membrane) is a biological…

Q: When sets of genes group together, the result can be multiple traits expressed as a single dominant…

A: Introduction :- Many traits and phenotypic characters in plants and animals, such as height, skin…

Q: A patient has reduced FEV1, and lower lung volumes overall.  What is your diagnosis?   the patient…

A: The quantity of air one can drive out of the lungs in one second is known as FEV1. Spirometry,…

Q: Happened? (There are at least expla 2. Drugs with names that end in "-mab" consist of anti- bodies,…

A: Our immune system consists many cells and organs such as Thymus (T cells), Bone marrow (B cells),…

Immunology

Immunology is the division of science involved with the immune reactions occurring in living organisms. The organisms are accustomed to evolving internal defense mechanisms to evade the invasion of microbial pathogens. Diverse cells are connected with stimulating the immune responses, which produce inhospitable conditions to the microbes prompting their lysis and thus inhibits the multiplication of the pathogens. The immune system can distinguish the pathogens through the aid of cellular intercommunication and launch responses to destroy them.