Backward? Bacteriophage T7 helicase moves along DNA in the 5'-to- 3'5'-to-3' direction. Other helicases have been reported to move in the 3'-to-5'3'-to-5' direction. Is there any fundamental reason why you would expect helicases to move in one direction or the other?
Q: 28. According to the central dogma of genetic information transfer (proposed by James Watson and…
A: Central dogma proposed by James Watson and Francis crick states the genetic information transfer in…
Q: How many sites? A researcher has isolated a restriction endonuclease that cleaves at only one…
A: Restriction endonuclease is defined as an enzyme responsible for cleaving DNA into small fragments…
Q: 3. The speed of DNA replication at a replication fork is about 100 nucleotides per second (on each…
A: The DNA replication is the process by which new DNA is synthesized from the old DNA by the…
Q: uisCUntinuous 4. The sequence of base triplets on the coding strand of part DNA molecule is…
A: tRNA is a RNA molecule that helps in protein synthesis. tRNA forms base pair with complementary…
Q: Just question 33
A: The error in the cell at the time of replication generally does not cause cancer as they are…
Q: primase The enzyme synthesizes the RNA primers required for DNA replication. Why are the RNA primers…
A: DNA has a double stranded structure. During DNA replication, the DNA double helix unwinds & each…
Q: TRUE OR FALSE] 11. The structure of the DNA, being super coiled, promotes increased viscosity of…
A: Nucleic acid was first discovered by Friedrich Miescher from the nuclei of the pus cells…
Q: 4. Is there any situation in which DNA is made based on a RNA template? If there is, explain with an…
A: Note: We will answer the first question since the exact one was not specified. Please submit a new…
Q: stranded helix by doubling back. Draw the detailed chemical structures for all the base- pairing…
A: Triple helix The triple-stranded DNA is also called the H-DNA, it is called so because three…
Q: 3a) In a hypothetical cell where "wobble" pairing was not allowed (i.e. every codon must be matched…
A: Transfer RNA or tRNA is defined as a molecule which helps to decode mRNA or messenger RNA into a…
Q: 1. Packaging of DNA in a Virus Bacteriophage T2 has a DNA of molecular weight 120 x 10° contained in…
A: The following steps are involved in the bacteriophage assembly process: (a) Head assembly triggered…
Q: 23. What process best describes the action of Taq DNA polymerase? a. Catalyzes hydrolysis of…
A: Taq DNA polymerase is the thermal stable DNA polymerase enzyme isolated from Thermus aquaticus. This…
Q: Q - Can you write one sequence of 15 nucleotides that can be produced using this transformational…
A: In this question, we need to find one sequence of 15 nucleotides from the given transformational…
Q: 4a in context to taking genomic DNA from eukaryotic cells and randomly shearing it into pieces of a…
A: Renaturation is a process of reformation of hydrogen bonds between the complementary single strands…
Q: True or False? 454 platform sequencing involves attaching single -stranded DNA fragments to beads,…
A: 454 platform sequencing This technology is a high throughput sequencing method which is based on…
Q: (n-m)! Count the number of ways in which: Guanıne, Adenine, Cytosine, Thymıne, Cytosine, and Guanıne…
A: Permutation infers the maximum number of possible arrangements by given things/ variables that can…
Q: Deficiencies in the activity of either dUTPase or DNA ligase stimu- late recombination. Why?
A: dUTPase- a dUTP diphosphatase is an enzyme that catalyses the chemical reaction dTUP+H2O/…
Q: Central Dogma Application: Using the basic concept of Process of central dogma provide the following…
A: According to the central dogma, the most common pattern of information in our cells is: From…
Q: Matching Type Choose the directionality of the given process. (4 points) What is the directionality…
A: Directionality is the property of being directional or maintaining a direction in general terms.…
Q: Altering Linking Number (a) What is the Lk of a 5,000 op circular duplex DNA molecule with a nick in…
A: Since we only answer up to 3 sub-parts, we’ll answer the first 3. If you need help with other sub…
Q: ing the following DNA sequence determine the amino acid sequence: AGAGGTCCGCGTTTAGACAT5' et Val Ser…
A: Complementary strand of RNA is formed by complementary base pairing that occurs between adenine and…
Q: explain why it is far less important for Primase to have proofreading activity than it is for DNA…
A: DNA proofreading is error correction process, in which DNA polymerase checks the each nucleotide…
Q: Proliferating Cell Nuclear Antigen (PCNA) is a ring-shaped protein that forms a clamp around DNA.…
A: Spectrophotometric analysis is the most widely accepted technique to determine the concentration of…
Q: I need question 31
A: Tautomeric shifts in nucleotide bases The purine and pyrimidine bases in DNA exist in two different…
Q: REPLICATION TRANSCRIPTION TRANSLATION Substrate a) ribonucleotides a) phosphates b) ribonucleotides…
A: Replication is the process of DNA synthesis and to synthesize DNA we require deoxyribonucleotides…
Q: Genetic application problem A couple in which the woman belongs to group 0 Rh- and the man is AB Rh…
A: Blood grouping is given by the presence of three different allele , that are A B and i where A and B…
Q: Mutated DNA Sequence #4 ТАСАС СТTGG CGACT АСТ... What's the mRNA sequence? (Circle the change) amino…
A: DNA is two stranded structure which make it own strand via replication process . It comprises of…
Q: 1.The RNAs acting in RNAi are about 18 nucleotides long. To judge whether it is possible to uniquely…
A: Introduction RNA Interference (RNAi) Is A Biological Mechanism In Which Double-stranded RNA…
Q: What length of DNA (based on the number of subunits) has a potential diversity close to 3 *10^16?
A: The length of the DNA is determined by corresponding to the base pairs in the DNA and the distance…
Q: likely be able to bind a Cyclic AMP DNA binding protein? (only one strand is shown but assume DNA is…
A: CRP is a transcription factor that, when complexed with cAMP, binds DNA and activates transcription…
Q: replication, resulting in a (e) Errors may change to the sequence of base triplets. Explain how a…
A: Ans- Errors that arise during the DNA replication because of the change in sequence of gene triplets…
Q: H2N 1.) Look carefully at this nucleotide: N- || НО-Р-О- N. OH a.) Number the carbons in the sugar…
A: DNA is a long, double-stranded, helical molecule composed of building blocks called…
Q: Calculating human genome If 1.5 percent of the human genome consists of protein-coding sequences,…
A: All humans have deoxyribonucleic acid (DNA) as constituent genetic material. This biochemical…
Q: 1. In what direction does a polymerase move when synthesizing a strand of mRNA? Briefly Explain. 2.…
A:
Q: he enzymes BamH I and Bal II recognise different sequences but leave the same sticky ends: BamH…
A: An enzyme that recognizes a specific sequence on the DNA strand and cuts the DNA into fragments is…
Q: As shown, five DnaA boxes are found within the origin of replication in E. coli. Take a look at…
A: E.coli. is a key model organism and has been used in so many research studies involving molecular…
Q: Template strand: 5'.GTCTCTTGACATTG... 3' if the nucleotide highlighted in yellow is mutated to a C,…
A: A silent mutation is a change of the succession of nucleotide bases which establishes DNA, without a…
Q: Yes or no? Is sequence of riboprobe identical to the mrna produced by gene in situ hybridization?…
A: Riboprobe are the synthetically made piece of RNA that will bind to target gene. And will be used in…
Q: True or false? DNA repair mechanisms all depend on the existence of two copies of the genetic…
A: RNA polymerase is an enzyme that converts a DNA sequence into an RNA sequence via the transcription…
Q: Quick help Only cell biology Which process is described in the following paragraph? During DNA…
A: DNA contains the instructions for an organism's or cell's development, reproduction, and death. DNA…
Q: Which statements are true? Explain why or why not.1 The different cells in your body rarely…
A: A gene is the essential physical and functional unit of heredity. Genes are comprised of DNA…
Q: 1) Say you have an organism with a genome of 1 thousand bases (103) and a forward primer made up of…
A: Since you have posted a question with multiple sub parts, we will provide the solution only to the…
Q: Yes or no? for each gene, transcription is initiated at origin of replication. does pre mrna…
A: Transcription initiation site is called +1 initiation site. This segment of +1 initiation site is…
Q: Mutation: Thiamine Dimers A. what is a mutagen or cellular process that leads to this mutation? B.…
A: DNA damage occurs either due to mutation or error that occurs during the processing of DNA such as…
Q: DNA What do thymine (T) and cytosine (C) have in common, that makes them different from Adenine…
A: There are two types of nitrogenous bases: purines and pyrimidine. Purines include adenine and…
Q: He follówing diagram of how protein AWESOME1 binds to it's target DNA, al effects of each of the 5…
A: A mutation is a permanent change in the nucleotide sequence of DNA that can occur during replication…
Q: Central Dogma of Molecular Biology from DNA to RNA to Protein, discussing the principles underlying…
A: Central dogma means the flow of information occurs from DNA to RNA, and RNA to proteins. Proteins…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Number of Okazaki Fragments in E. coli and Human DNA Replication Approximately how many Okazaki fragments are synthesized in the course of replicating an E. coli chromosome? How many in replicating an “average� human chromosome?Multiple Replication Forks in E. coli II On the basis of Figure 28.2, draw a simple diagram illustrating replication of the circular E. coli chromosome (a) at an early stage, (b) when one-third completed, (c) when two-thirds completed, and (d) when almost finished, assuming the initiation of replication at oriC has occurred only once. Then, draw a diagram showing the E. coli chromosome in problem 3 where the E. coli cell is dividing every 20 minutes.Semiconservative or Conservative DNA Replication If 15N-Iabeled E. coli DNA has a density of 1.724 g/mL, 14N-labeled DNA has a density of 1.710 g/mL, and E. coli cells grown for many generations on 14NH4+as a nitrogen source are transferred to media containing 15NH4+as the sole N-source, (a) What will be the density of the DNA after one generation, assuming replication is semiconservative? (b) Suppose replication took place by a conservative mechanism in which the parental strands remained together and the two progeny strands were paired. Design an experiment that could distinguish between semiconservative and conservative modes of replication.
- Recombination in Immunoglobulin Genes If recombination between a Vkand Jkgene formed a CCA codon at codon 95 (Figure 28.41), which amino acid would appear at this position?Multiple Replication Forks in E. coli I Assuming DNA replication proceeds at a rate of 750 base pairs per second, calculate how long it will take to replicate the entire E. coli genome. Under optimal conditions, E. coli cells divide every 20 minutes. What is the minimal number of replication forks per E. coli chromosome in order to sustain such a rate of cell division?May you please help me with this? A sample of purified DNA was incubated with deoxyribonuclease (DNAse) at 37oC. An aliquot was removed from the reaction mixture every minute for 5 minutes and the A260 recorded. The following data were obtained. Time (min) A260 0 0.60 1 0.64 2 0.67 3 0.70 4 0.72 5 0.73 Describe the action of deoxyribonuclease on DNA and explain the increase in A260.
- 4a in context to taking genomic DNA from eukaryotic cells and randomly shearing it into pieces of a constant size, why do some of the genomic DNA fragments re-nature so much more quickly than other fragmentsTick the correct statements: Remember: Tautomers are structural isomers that differ from each other based on the position of the proton(s) and their double bonds. ( ) The nitrogenous bases of nucleic acids, which contain heterocyclic and analogous nuclei, can adopt different tautomeric forms involving multiple H+ that are exchangeable depending on the medium. In DNA, spontaneous formation of smaller tautomers appears to contribute to mutagenic errors during DNA replication, while in RNA, they seem to be related to increased structural and functional diversity of enzymes and RNA aptamers (research this and confirm if it is false or real) ( ) in relation to the figure, anomer 1 has beta stereochemistry with respect to the C anomeric of the pentose, and is making an N-glycosidic bond ( ) in relation to the figure, anomer 1 has alpha stereochemistry with respect to the C anomeric of the pentose, and is making an N-glycosidic bond ( ) In general, in naturally occurring nucleosides,…Central Dogma of Molecular Biology from DNA to RNA to Protein, discussing the principles underlying the transfer of information in a biologic system and its regulation. However, recent research seems to challenge certain aspects of Crick’s Central Dogma. Does the Central Dogma still stand today? If not, can you find an example for a type of information transfer that is not explicitly covered by the Central Dogma (or even violates it)?
- Yes or no? during situ hybridization digoxygenin can be recognized by antibody. Does pcr generate linear moleyof dna? in situ hybridization reveals distribution of a gene's mrna in an organism.Need help 1) Say you have an organism with a genome of 1 thousand bases (103) and a forward primer made up of 5 nucleotides (aka, a 5-mer) a)How many possible 5-mers are there? Remember that each position in the 5-mer has one of four nucleotides. b) Pick a 5-nucleotide position at random in the genome: what’s the probability that your forward primer matches there? Focus for now just on one strand of DNA. c) Pick a random 5-nucleotide position in the genome: what’s the probability that your forward primer does NOT match there? Focus for now just on one strand of DNA. d) How many physical locations might your forward primer sit in the genome? Focus just on one strand of DNA. Ignore whether or not it matches at a given location. this is one question with different parts. I would really appreciate it if all parts are answered. and I will defiantly rate.Please help C. Even in automated sequencing, where you can include all 4 ddNTPs in one reaction, you need to include "normal" dNTPs as well as the ddNTPs - why are these necessary? Why can't you just put in the ddNTPs, since you've got all four of them available to the DNA polymerase?