Beta subunit of ATP synthase is currently in its loose state. At what phase of ATP synthesis is it at?
Q: During protein synthesis, which step does NOT require energy? dissociation of the 70S ribosome after…
A: The process of gene expression involves two steps: transcription and translation. Translation is the…
Q: Identify the type of inhibition (competitive, noncompetitive, uncompetitive) 1 Enzyme B Inhibitor…
A: Introduction: Enzyme kinetics involves the study of the rate of chemical reactions increased by a…
Q: Identify the enzyme involved in this reaction from the Pentose Phosphate Pathway. NADP+ OH -H #V₂ H.…
A: In animal tissues, glucose has two possible fates: be oxidised into carbon dioxide and water by…
Q: determine if stirring (Pé > 1) is more efficient than diffusion (Pé < solutions. “Stirring" here can…
A: U
Q: A student is trying to add 15.0 ng of DNA template to a 20.0 µL PCR. The DNA template is at a…
A: Polymerase Chain Reaction or PCR is a method to make multiple copies of DNA starting from a small…
Q: The production of amino acids from proteins is an example of: a. a non-enzymatic reaction b.…
A: Proteins are large molecular weight polymers of amino acids with diverse biological functions. Many…
Q: In a Myoglobin and azide ligand-receptor binding experiment, instead of using 3.5 µM myoglobin you…
A: Myoglobin acts as oxygen reserve in the muscle cells. Myoglobin (Mb) has higher affinity towards…
Q: What is the function of sodium dodecyl sulfate (SDS) in SDS-PAGE? stabilizes the gel matrix,…
A: Electrophoresis means migration of charged particles under the influence of an electric field.…
Q: Which factor does NOT represent a barrier that prevents a reaction from taking place? substrate…
A: Reaction is a process by which a set of molecules is transformed to another. Many factors effect the…
Q: For the mutation of the enzyme below, describe the effect it will have on carbohydrate metabolism.…
A: Fructose 2,6-bisphosphate is an allosteric activator of the enzyme Phosphofructokinase-1 (PFK-1) ,…
Q: What is the function of the alcohol in the extraction of DNA? What is the property/characteristics…
A: DNA extraction involves different steps which include, the breaking of cells to open and…
Q: The enzymatic activity of PFK1 is generally measured by set- ting up a coupled enzyme assay system…
A: Glycolysis is the collection of 10 enzymatically catalysed reactions that sequentially oxidises a 1…
Q: When k2 >> k-1, KM approximates the affinity of the enzyme•substrate complex. The (circle one)…
A: Km is also known as Michaelis constant. It is named after German biochemist Leonor Michaelis. It is…
Q: Sketch 1/v v.s. 1/[s] for enzyme 1 and enzyme 2 where enzyme 1 has same Vmax as enzyme 2 but has…
A: Enzymes are bio-catalyst that participate in biochemical process and they are highly specific in…
Q: What's your next step to characterize this enzyme?
A: Enzymes are high molecular-weight proteins that catalyse biochemical reactions. They contain an…
Q: Which of the following is zwitterion structure of the amino acid alanine? O NH3 NH3 O NH₂ O OH O no…
A: Amino acids are biomolecules that have an amino group (-NH2), a carboxyl group (-COOH) and a side…
Q: What will be the result for each qualitative test if the intact casein contains the following…
A: Proteins are folded peptides. Peptides are made up of amino acid residues linked via a peptide bond.…
Q: A positive biuret test would indicate the presence of what type of molecules in the filtrate
A: Biochemical tests are lab experiments conducted to determine the identity of an unknown analyte in a…
Q: fructose-6-phosphate + ATP fructose-1,6- biphosphate + ADP AG = 30.5 and 16.3 respectively Standard…
A: The Gibbs free energy (G): It is the thermodynamic function that best captures the energetics of…
Q: The transition state of a reaction is O easily isolated using column chromatography. by definition…
A: The completion of a chemical reaction, from the substrate to the product involves the formation of…
Q: Use the provided theoretical titration curve of histidine in answering the questions asked. Hd 14 12…
A: Histidine has 3 ionizable groups. The alpha-carboxylic acid group, the alpha-amino groups and the…
Q: Chemical biologists view metabolism's citric acid cycle as its fulcrum. The enzyme isocitrate…
A: Citric acid cycle: (Krebs cycle) Citric acid, a tricarboxylic acid that is frequently referred to…
Q: Yeast cells are grown with galactose as the sole carbon source and ATP levels are abundant. Describe…
A: GAL genes: The GAL genes, which include structural (GAL1, GAL10, GAL2, and GAL7) and regulatory…
Q: Test for Unsaturation. Reagent’s Composition Observations: Test Samples Reaction with…
A: Fatty acids are carboxylic acids with a hydrocarbon chain ranging from 4 carbon to 36 carbons. The…
Q: 16-24 epiners are encintomers. Draw Haworth projection a) b) When the molecule formulas for dímers…
A: Carbohydrates or carbs are maconutrient consisting of Carbon, hydrogen and oxygen atoms. In nature…
Q: The Na-glucose symport system of intestinal epithelial cells couples the \"downhill\" transport of…
A: Recall that: The free energy for the transport of uncharged solute from a region where its…
Q: Calculate the pI of the peptide KLMRDSP (pKa = 3.5, 3.9, 9.5, 10.0, 12.5).
A: The amino acids contain ionizable groups. The ionic form of these groups depends upon the pH of the…
Q: The biexponential equation for a two compartment model drug is C1,t = 50.0e-1.64t + 20.0e-0.147t.…
A: Pharmacokinetics: The study of the kinetics of drugs absorption, distribution, and elimination…
Q: Based on its R-group, how would the amino acid arginine be classified? O hydrophobic O neutral polar…
A: There are 22 different standard amino acids present. The amino acids are classified in different…
Q: Align two sequences: horizontal - GGAATGG, vertical – ATG, m = 1, mm = 0, g = -1. Use the table…
A: Global Alignment: It is a bioinformatics algorithm used to align protein or nucleotide sequences. A…
Q: In the tertiary structure of a protein, glutamine can interact with O valine; hydrophobic…
A: Proteins are bio molecules with vast diversity in their structure. They exhibit four levels of…
Q: Mutual intermediates of catabolism of proteins, carbohydrates and lipids; their role in the…
A: Catabolism is the process of breaking down of complex compounds into simple molecules. The catabolic…
Q: 3. Explain why the structure of myoglobin makes it function well as an oxygen-storage protein…
A: Note: Hi! Thank you for the question. We are authorized to answer one question at a time. Since you…
Q: Based on the amino acids present in the segments between the breakers, what do you predict the…
A: A protein's function depends on its structure. There are four levels of protein structure: primary,…
Q: 1. DNA: ATACGAAATCGCGATCGCGGCGATTCGG mRNA: Codon: Anticodon: Amino Acids: 2. DNA:…
A: During the process of transcription, one strand of the DNA act as the template for the synthesis of…
Q: A sphingoglycolipid has a "head and two tails" structure. Classify each of the following components…
A: Lipids are a chemically diverse group of biomolecules that have two things in common: low…
Q: A.Provide the name for the D-monosaccharide “1” in the above image. You may ignore the alpha or…
A: There are four classes of biological macromolecule: nucleic acids, proteins, lipids and…
Q: You are a research scientist studying miRNA processing. You currently know everything about the…
A: Dicer is also known as helicase with RNase motif. It belongs to RNAse III family. Dicer cleaves…
Q: At pH 3, the R-group of histidine is_______ and O protonated; neutral O protonated; positively…
A: Histidine (His or H) is an essential amino acids used in the biosynthesis of proteins. It contains…
Q: Can I please get help? 1. Describe the morphological phenotypes you see in the experimental…
A: Neurons: Sending, receiving, and transmitting electrochemical impulses throughout the body is the…
Q: Inhibitors for this reverse transcriptase fall in two classes: nucleoside analog inhibitors (NRTIs)…
A: Reverse transcriptase is an enzyme that synthesizes DNA from RNA. Reverse transcriptase catalyzes…
Q: Given the following enzyme-catalyzed reaction, identify the class and subclass of the enzyme…
A: Enzymes are classified into six classes. They are oxidoreductases, transferases, hydrolases,…
Q: (c) ( To identify the critical enzyme resi- due:substrate interaction and determinant of sub- strate…
A: Phosphotyrosine protein phosphatases (PTPases): These are a group of enzymes that catalyze the…
Q: Draw the following Lipids in: A) Condensed (detailed) Structure, B) its Block Diagram. C)…
A: Phospholipids are compound lipids composed of fatty acid, alcohol, nitrogen containing molecules,…
Q: Provide 5 differences of HDL and LDL and explain each biochemically.
A: "Lipoproteins," a class of proteins, carry cholesterol through into the blood. Two different…
Q: 4. An enzyme-substrate complex has a Kg = 100 nM. A competitive inhibitor with which of the…
A: KD (Dissociation constant) is the amount of ligand molecules that is required to fill the binding…
Q: Describe the reaction catalyzed by invertase. To which class of enzymes does invertase belong to?
A: Chemically, carbohydrates are polyhydroxy aldehydes/ketones. They have the general formula :…
Q: The TPOX locus is one of the genetic loci used for forensic analysis of DNA. The TPOX locus has the…
A: Forensics DNA profiling can be used to solve old or unsolved crimes and to identify the person…
Q: What will be the result for each qualitative test if the intact casein contains the following…
A: Protein qualitative tests are test used to estimate the proteins qualitative way, i.e. it identifies…
Q: Which of the following which of the following reactions is an endergonic reaction that could…
A: In a general reaction such as: aA + bB ⇌ cC + dD At equilibrium (steady state), the concentration of…
Ht
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- The Relative Efficiency of ATP Synthesis in Noncyclic versus Cyclic Photophosphorylation If noncyclic photosynthetic electron transport leads to the translocation of 7 H+/2e- and cyclic photosynthetic electron transport leads to the translocation of 2 H+/e-, what is the relative photosynthetic efficiency of ATP synthesis (expressed as the number of photons absorbed per ATP synthesized) for noncyclic versus cyclic photophosphorylation? (Assume that the CF1CF0-ATP synthase yields 3 ATP/14 H+.)ATP synthase of mitochondria: the structure and principles ofwork. F0and F1subunits of ATP synthase: their functional valueTrue or false: F1 unit of ATP synthase is capable of synthesizing 3ATP molecules per a complete revolution. F1 unit can synthesize 4 or 5ATP molecules if the c subunit of F0 unit has more than 12 proton binding peptides. Unlike Complex I inhibitors, Complex IV inhibitors can shut down the entire ETC.
- Which part of the FoF1 ATP synthase is the pore through which protons (H+) move? the a subunit of the Fo static component the gamma subunit of the F1 mobile component the beta subunits of the F1 static component the c subunits of the Fo mobile componentEnergy production pathway is targeted by drugs in the malignant (cancerous) cell to control an X cancer type. Use your speculation and tell targeting and destroying which one energy producing agent of the oxidative phosphorylation will be the most effective in blocking most of the energy production and why?Dissipation of the proton gradient is required for Formation of ATP from ADP+Pi Overcoming entropy to bring the reactants in close proximity Tight binding of ADP+Pi to the enzyme Release of ATP from ATP synthase
- fill in the blanks ATP synthesis occurs at the ( ) subunit of ATP syntahase via conformational changes to the ( ) protein subunit.Please explain why hydrolysis of ATP can release much energy by describing how the products of ATP hydrolysis are more stable. Please describe how ATP hydrolysis is used for glucose absorption (i.e. picking up glucose from the small intestine into epithelial cells)Which conformation of the F1 subunit of ATP Synthase releases ATP? A. αΒ-ADP B. αΒ-ATP C. αΒ-Empty D. None of the above
- Contrast, in terms of ATP production, the oxidation of glucose to ethanol with the oxidation of glucose to oxaloacetate. How many ATP molecules are produced for each process? glucose to ethanol: ____ ATP molecule(s) glucose to oxaloacetate: _____ ATP molecule(s) Please answer very soon will give rating surelyA 75 kg person doing light work requires about 3000 kcal of food energy perday, 40% of which is actually used by the body’s cells. (The other 60% is lostas heat and in waste products.) Before being used by the cells, effectively allof this energy is stored in ATP, which is then cleaved into ADP and PO3−2 , with the release of 12.5 kcal per mole of ATP.(a) How many moles of ATP are turned over per day in this fashion? Whatmass of ATP does this correspond to? (The molecular weight of ATP is507 g/mol.)(b) The body actually contains approximately 5 g ATP. Estimate the averagerecycle time for an ATP molecule. You see that it is much more efficientto reuse ADP rather than to synthesize it de novo (from scratch).dtermoine numberof ATPS GENERATED FROM COMPLETE oxidation of fructose-6-phosphate isocitrate stearidonic acid [18 carbons triangle 6,9,12,15] indicate where everything comes from ex ATPS FROM GLYCOLYSIS , NADH FROM TCA ETC LIST ALL
