4. An enzyme-substrate complex has a Kg = 100 nM. A competitive inhibitor with which of the following Ki values will be most effective at inhibiting this enzyme? A) K = 10 nM B) K₁ = 100 nM m ww C) Ki= 1000 nM m ww D) None of the above - only the KM is important Briefly explain:
Q: Give a CHEMICAL test that can differentiate the pair of sugars and give the results for both. No…
A: Introduction: Carbohydrate is an important source of energy that is important for all living…
Q: ) How many moles of ATP can be gained from the catabolism of the following substrates to pyruvate?…
A: Since you have asked multiple questions with multiple subparts, we will solve the first question for…
Q: Does phosphorylation of an enzyme always increase its catalytic activity ?
A: The phosphorylation of proteins modulates various aspects of their functions. In eukaryotes the…
Q: Does the apparent KM increase / decrease in the presence of a competitive inhibitor?
A: Introduction: The term enzyme kinetics involvs the study of chemical reactions that are catalyzed…
Q: Which of the following which of the following reactions is an endergonic reaction that could…
A: In a general reaction such as: aA + bB ⇌ cC + dD At equilibrium (steady state), the concentration of…
Q: In the final step of the citric acid cycle, malate is oxidized to regenerate the oxaloacetate…
A: In a general reaction such as: aA + bB ⇌ cC + dD At equilibrium (steady state), the concentration of…
Q: What effect does a negative effector have on the graph of reac- tion rate (V) vs. [substrate] for an…
A: INTRODUCTION : Allosteric enzymes : Allosteric enzymes are those enzymes which have an additional…
Q: 1x GGCGAUGGGCAAUAAACCGGGCCAGUAAGC Identify the start codon, and determine the complete amino acid…
A: Translation is the process of synthesis of proteins from mRNA. Proteins are synthesized by adding…
Q: Proteins destined for the peroxisomes can be translocated in their functional shape. True False
A: Protein targeting is a biological process by which the cells localize the proteins in different…
Q: 1. Calculate the initial velocity (Vo) of a Michaelis-Menten reaction as a fraction of Vmax when [S]…
A: For a one-substrate enzyme-catalyzed reaction, the Michaelis-Menton equation shows the quantitative…
Q: What compound of phosphorus is found in nucleic acids? What are the products of hydrolysis in RNA…
A: DISCLAIMER FOR MULTIPLE Since you have asked multiple question, we will solve the first question…
Q: 4. Below each item, identify WHAT it is, indicate WHERE in the cell it is used/made (cytoplasm or…
A: Glycolysis is the metabolic pathway that converts glucose into pyruvate. The free energy that is…
Q: A formula for an antifungal shampoo con- tains 2% w/v ketoconazole. How many grams of ketoconazole…
A: Percent weight/volume is the amount of solute dissolved in 100ml of the solution.
Q: WHAT I CAN DO Activity 6: I learned something? Procedure: In your own understanding answer the…
A: Anaerobic A-lactic energy system: A third system generates ATP at a very high rate when quick,…
Q: Kt of glucose for GLUT1=3 mM, GLUT2=17 mM, GLUT 3=1.3 mM, and GLUT11=0.3 mM. Sketch a graph with…
A: The equation that gives the rate of transport of molecule is similar to the rate equation of…
Q: Analyze each item carefully and write your complete solution. Cysteine is an important amino acid…
A: Titration curve: Titration curves are created when successive additions of acid or alkali cause the…
Q: Name three metabolic processes in the cell that are enhanced and two that are inhibited in response…
A: Insulin is a peptide hormone that regulates blood glucose in levels in the body. It decreases the…
Q: 1. The structure is a monomeric unit of what polynucleotide: DNA or RNA? 2. What is the bond that…
A: The four types of macromolecules are nucleic acid, protein, lipid and carbohydrate. The nucleic…
Q: Which of these structures would you expect to find as part of the transmembrane portion of an…
A: All biological membranes share one common feature: they are impermeable to polar molecules and…
Q: Thick filaments are part of the I band contain actin O contain myosin but thin filaments do/are not.…
A: In each microfibril, actin thin filaments and myosin thick filaments are organized into a linear…
Q: Component 1 PCR buffer 2 MgCl2 3 dNTP mix 4 SSR forward primer 5 SSR reverse primer 6 Taq polymerase…
A: PCR is also known as a polymerase chain reaction which is generally used to amplify the template DNA…
Q: What is binding energy? What do negative and less negative energies represent? How does this relate…
A: Binding energy is the amount of energy required to separate a system into its constituents. If we…
Q: Describe various detection methods used in High-Performance Liquid Chromatography (HPLC) and types…
A: High-performance liquid chromatography or high-pressure liquid chromatography, is an analytical…
Q: BssH II Primer design worksheet ...KS primer binding site T7 Promoter Bsp 1061 Çla I Hind III EcoR V…
A: The polymerase chain reaction (PCR) is a procedure that can make multiple copies of target DNA by…
Q: A student is trying to add 9.0 pmol of primer mix to a 20.0 µL PCR. The primer mix is at a…
A: Equation of dilution: M1 × V1 = M2 × V2 where: • M1 is the molar concentration of the stock…
Q: Glutamine is an amino acid that has -CH₂-CH₂-CO-NH₂ as its R group. The R group of the amino acid…
A: There are hundreds of different amino acids however only 20 different amino acids participate in…
Q: Explain IN DETAIL the reactions and processes of alcoholic and lactic acid fermentation. Include…
A: The process of cellular respiration leads to catabolism of pyruvate after the glycolytic pathway.The…
Q: The following scheme shows how acetylcholine esterase (AChE) enzyme hydrolyzes acetylcholine (ACh).…
A: A cholinergic enzyme called acetylcholinesterase (AChE) is mainly present in postsynaptic…
Q: C. TBARS Assay 1. In a test tube, mix 1 mL of the samples and 1 mL of thiobarbituric acid reagent.…
A: Sources of error can be defined as the factors which affect the accuracy and precision of an assay.…
Q: Shown below is a theoretical titration curve of histidine (amino acid). Use the provided titration…
A: Histidine is a basic amino acid with an alpha-carboxylic group, an alpha-amino group, and a…
Q: what are the molecular descriptors of phosphatidylinositol?
A: Phosphoinositides are the phospholipids comprising a water soluble head group i.e. myoinositol…
Q: Plant vacuoles must also maintain an optimum pH for its acid hydrolases. True False
A: Enzymes are high molecular weight proteins that catalyse biochemical reactions. Their catalytic…
Q: Mach column (A) with Column (B)?* Waxes Serous gland Sphingolipids Fatty acid Beta oxidation Ketone…
A: Lipids are classified into three groups as simple lipids, compound lipids, and derived lipids based…
Q: Search the protein data bank (https://www.rcsb.org/)and find an image of one protein that is found…
A: The SARS-CoV-2 virus is the infectious disease known as coronavirus disease (COVID-19). A group of…
Q: Benedict's test Green precipitate A. reducing sugars not presnt B. Reducing sugar presennt…
A: 1. Ans: A. Reducing sugar not presennt 2.Ans: B. Ketose present 3.Ans: A. Amlyose present
Q: After you collect the reaction data, at time O the positive control absorbance is 0.92 and after 24…
A: A spectrophotometer can measure the amount of light absorbed by a biomolecule and we can use that…
Q: Which of the following statements is/are TRUE about the Lock and Key model of enzyme-substrate…
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: Disruption of which process will have the greatest impact on the number of electron carriers used by…
A: Disruption of which process will have the greatest impact on the number of electron carriers used by…
Q: 4. You are to choose the members of an expedition that will climb several high mountains. Each…
A: Note: Hi! Thank you for the question. We are authorized to answer one question at a time. Since you…
Q: The Hb Yakima variation is caused by the mutation D99H, which results in a shift in oxygen binding…
A: Hemoglobin binds to oxygen and it appears in two state. The T state (tensed) and R state (relaxed).…
Q: impact on the number of electron carriers used by the electron transport chain? Select one: The…
A: Introduction Cellular respiration is of two types: aerobic respiration and anaerobic respiration.…
Q: Glyceraldehyde-3-phosphate + NAD+ + Pi → 1,3-bisphosphoglycerate + NADH + H+ ∆G0’ =+6.3 kJ…
A: In a general reaction such as: aA + bB ⇌ cC + dD The free energy changes in chemical reactions are…
Q: result of other cligestive enzymes for chemical chgestion like try pon, which are not as acidic a…
A: Enzymes are biological catalysts that increases the rate of biochemical reactions. The activity of…
Q: is it true that aplha and beta are made up of same amino acids but Beta chain is longer than alpha…
A: Hemoglobin (Hb) is a complex protein which is consist of two parts - the heme and the globin. Heme…
Q: Which amino acid pair constitutes the hydrophobic patch on sickle cell hemoglobin that results in…
A: Sickle cell disease is caused due to inversion of one base pair (A -> T). Due to which, the sixth…
Q: Make use of the table below in answering the questions asked: Amino acid pK₁ pK₂ PK3 Isoleucine 2.32…
A: The amino acids have ionizable groups in them. The ionic form of the amino acids/ proteins depends…
Q: Does the presence of a competitive inhibitor increase / decrease the apparent affinity of the…
A: There are three types of enzyme inhibitors. They are competitive, non-competitive and mixed…
Q: Explain how RNA Pol II switches from strand initiation to strand elongation
A: RNA Polymerase II is a mulit-iprotein enzyme that transcribes DNA to messenger RNAs. RNA Pol II…
Q: Use the provided theoretical titration curve of histidine in answering the questions asked. Hd 14 12…
A: Histidine has 3 ionizable groups. The alpha-carboxylic acid group, the alpha-amino groups and the…
Q: H H-C=0 ATP H-C-OH HO-C-H V H-COH HOOH Hexokinase H-C-OHO meras-C-OHO kinase H OH H-C-O-P-O H o- HO…
A: Glycolysis is a metabolic pathway during which glucose molecule splits into pyruvate molecules with…
Step by step
Solved in 3 steps
- 1. Activatotrs are types of A. inhibitor B. cofactor C. enzyme D. substrate 2. Which of the following does NOT affect enzyme selectivity ? A. Electrostatic interactions B. Molecular shape C. hydrophillic Interactions D. None of these answers are correct1. The concentration of substrate X is high. What happens to the rate of the enzyme-catalyzed reaction if the concentration of substrate X is reduced? Explain. 2. An enzyme has an optimum pH of 7.2. What is most likely to happen to the activity of the enzyme if the pH drops to 6.2? Explain4. a. Use the data in the graph above to estimate a KM value for the enzyme in the presence of these metabolites, and enter them into the table below. b. Classify these metabolites as either activators or inhibitors, and explain your rationale below.
- 1. As seen in the picture: - What kind of inhibition (competitive, uncompetitive, mixed) is involved? - Calculate Vmax and Kmax in the absence and presence of inhibitor A Show complete solution.1. There are two major categories of enzyme, inhibition, name, and describe them.  1a. Reverse inhibition can be overcome to allow the enzyme to resume is Catley activities. Describe how reversible inhibition can occur and how it can be over come.Which of the following statements about the allosteric site is true? a. The allosteric site is a second active site on a substrate in a metabolic pathway. b. The allosteric site on an enzyme can allow the product of a metabolic pathway to inhibit that enzyme and stop the pathway. c. When the allosteric site of an enzyme is occupied, the reaction is irreversible and the enzyme cannot react again. d. An allosteric activator prevents binding at the active site. e. An enzyme that possesses allosteric sites does not possess an active site.
- In an enzymatic reaction: a. the enzyme leaves the reaction chemically unchanged. b. if the enzyme molecules approach maximal rate, and the substrate is continually increased, the rate of the reaction does not reach saturation. c. in the stomach, enzymes would have an optimal activity at a neutral pH. d. increasing temperature above the optimal value slows the reaction rate. e. the least important level of organization for an enzyme is its tertiary structure.Which of the following methods is not used by enzymes to increase the rate of reactions? a. covalent bonding with the substrate at their active site b. bringing reacting molecules into close prosimity c. orienting reactants into positions to favor transition states d. changing charges on reactants to hasten their reactivity e. increasing fit of enzyme and substrate that reduces the energy of activation5. a) Why would an enzyme that is effective with one reaction have no effect on another reaction?
- 1. Make a Lineweaver-Burk plot and use the plot to complete the information in the table and the following questions. a. Is it possible for the enzyme to overcome the effect of the inhibitor in question from the chart. Explain. b. What prevents this enzyme from being an even more catalytically efficient enzyme? c. What do single molecule data indicate about the validity of ensemble data?d. What is the reason that humans are insensitive to sulfa drugs?1. Can you describe how electrostatic and steric considerations may lead to preferential stabilization of the transition state at an enzyme active site? 2. What factors are involved in “transition-state complementarity”?3. What is the marker for the enzyme’s optimum condition?