What organism produced this gene sequence? Provide the full genus and species name. Make sure to spell it correctly! (Hint: Use "standard database" and not the "TRNA database" in your search.) >Sequence2c GCGGTTCCACAAGACCCTGAGGCGCCTGGTGCCTGACTCGGACGTCCGGTTCCTCCTCTC
Q: Suppose you received two cultures from a reactor biological: one containing a species of Gram negati...
A: All of life forms can be divided into three domains, based on the cell type: Bacteria, Archaea and ...
Q: How do you prepare 50 ml of 20 mg/ml proteinase K from 50 mg/ml stock solution
A: Proteinase K is a serine proteinase enzyme used to digest proteins. It is produced from a mold(fungu...
Q: Chemically, Olestra is made of a six-carbon backbone and six fatty acid attachments. No nutrients ar...
A: Olestra- Indigestible fat and composed of 6 fatty acid attachments.
Q: 21) Compute the moles of FADH2, NADH, GTP generated and NADPH consumed in the dissimilation of one m...
A: Lipids are easily soluble in nonpolar solvents such as benzene, ether, ...
Q: 3. The compound trypsin is a digestive enzyme produced by the pancreas. Enzymes are biological catal...
A: Enzymes are proteins facilitating various chemical reactions. They increase the rate of chemical rea...
Q: Summary Chart Macromolecule Monomer Polymers Bonds Functional Groups Examples CH2OH CH2OH он - CH,-C...
A: Macromolecules are the molecules of high molecular masses. These are composed numerous small molecul...
Q: 26. Dietary triglycerides are hydrolyzed by pancreatic lipase, which is related to but distinct from...
A: The pancreas is a heterocrine gland because it secretes digestive juices and hormones. Pancreatic am...
Q: What distance separates base-pairs in the Watson-Crick model of DNA? O 2.3Å O 3.4Å O 4.5Å O 5.6Å
A: DNA is a double helix structure that is made up of two long strands that are coiled around a central...
Q: Starting from formaldehyde, ammonia, hydrogen cyanide, carbon dioxide, ethene and water as needed, s...
A: 4.5 billion years ago our planate originate from the solar system. at 1st billion years...
Q: activity? To answer the question: a) name the hormone, controlling the lipid metabolism in adipocyte...
A: The breakdown or storage of fats for energy, as well as the production of structural and functional ...
Q: how/why you will characterize the proteins (whether impurities or dsRed.m1) as it comes off the DEAE...
A: Diethylaminoethyl cellulose (DEAE-C) is a positively charged, hydrophilic, weak anion exchange type ...
Q: SDS-PAGE gels are useful in determining the molecular weights of proteins; however, the molecular we...
A: SDS-PAGE is an acronym for sodium dodecyl sulfate–polyacrylamide gel electrophoresis. It’s a mass-ba...
Q: How do D-amino acids differ from L-amino acids and what are the biological roles that are played by ...
A: Amino acids are monomers of protein they are linked with each other by forming peptide bo...
Q: State the differences between "planar" and "column" stationary phases and provide examples of each.
A: Chromatography techniques are based on the stationary phases used in separation.
Q: The ionizable side change (-OH) of a synthetic amino acid has a pKa of 6.54. Find the amino acid's i...
A: The pH at which the amino acid has no net charge and is electrically neutral is called isoelectric p...
Q: How do Tetramethrin and Lambda-Cyhalothrin chemicals behave in water?
A: Pyrethroids are chemical compounds that are derivatives of pyrethrins, produced by chrysanthemum flo...
Q: do archaebacteria have autotroph or heterotroph nutrients
A: Nutrients are the components of food like carbohydrates, fats, vitamins, proteins, etc. These nutrie...
Q: For the following, calculate pka, and pka, of 1 Glycine, determine the 2 buffering regions, and calc...
A: Glycine is an amino acid with H-atom as the side chain. The isoelectric point of a amino acid (pI) i...
Q: Given the following question on the image identify the following:1. Total number of acetyl coA molec...
A: Maltose is a carbohydrate and it gets oxidized through glycolysis in cytoplasm and through the TCA c...
Q: You suspect that the mRNA encoding the guanine biosynthetic genes of Bacillus subtilus contains an a...
A: Before we get into figuring out a way to test the above hypothesis, we need to have a good idea on t...
Q: What is the one ingredient which turns up in all of the formulas and where does it come from? How an...
A: Tetrodotoxin: Tetrodotoxin is a low-molecular-weight neurotoxin which is a wide variety of taxa. It...
Q: Complete the following paragraph describing the fate of the second 14CO-acetyl-CoA molecule incorpor...
A: The glyoxylate produced in the isocitrate reaction combines with 2nd molecule of acetyl coa in the m...
Q: n the capillary electrophoresis therr are two most common methods of sample introduction explain the...
A: Capillary electrophoresis (CE) is a electrokinetic sample separation method that is performed in su...
Q: Evaluate the special traits of microbes in bioremediation of oil spill and their mechanism in degrad...
A: Process of removal of hramful/toxic substance using microbes or plant is called Bioremediation. Such...
Q: + J. Draw the structure of the following molecules and complete the table. Aldose/ Pentose/ Mono/Di/...
A: Carbohydrates: Carbohydrates are polyhydroxy aldehydes or ketones that are primarily produced by pl...
Q: To which omega family this fatty Acid belong? 22: 6 A7, 10, 13, 16, 19 Draw 22: 6 A 4, 7, 10, 13, 1...
A: In fatty acid nomenclature, α- carbon refers to the second carbon, β-carbon refers to the third carb...
Q: Sam does not consume alcohol, while his brother Sebastian regularly drinks large quantities of alcoh...
A: Liver, the largest gland in the human body has various secretory and metabolic functions. It secrete...
Q: Give the functions of the following ingredients, then name a branded/commercial skin or hair care pr...
A: Ozokerite wax is dark brown or light yellow color mineral wax. It is made up of carbon and h...
Q: WHAT ARE THE DIFFERENCES OF MONOSACCHARIDES, DISACCHARIDES AND POLYSACCHARIDES IN TERMS OF: STRUCTUR...
A: Carbohydrates are macromolecules composed of carbon, hydrogen, and oxygen. Carbohydrates are classif...
Q: Is this an L or a D amino acid? Explain.
A: Amino acids are the building blocks of proteins which are composed of amino group (NH3+), carboxyl g...
Q: Which of the following are true about aspirin
A: The question is all about the drug aspirin i.e acetylsalicylic acid that is used to reduce pain and ...
Q: HO, но. но NO2 G .F O,N" NO2 Br F 1. Provide the mechanism for the chemical reaction of pigment F wi...
A: The pigment in the question are Azo pigment/dye and is organic compound contains Azo group (-N=N-). ...
Q: What are the concepts of specificity, competition, and saturation as they relate to enzymes. Include...
A: Enzymes are biocatalyst that increases the speed of reaction by lowering the activation energy....
Q: A peptide has the following amino acid composition: 2 Met, 2 Phe, 2 Glu, 1 Arg, 1 Lys, 1 Val, 1 Leu,...
A: Small molecules called amino acids to form the building blocks of proteins. In chemistry, an amino a...
Q: Why are polyunsaturated omega-3 fatty acids considered as good for our health? Explain such phenomen...
A: Fatty acids are important components of lipids. Fatty acids are composed of hydrocarbon chain and a ...
Q: What is the term applied to the trinucleotide shown by the arrow? 5' AU Ру AGGCC G C G G G ACCACCUGe...
A: This a structure of tRNA, The tRNA molecule has a distinctive folded structure with three hairpin lo...
Q: Which of the following peptides will likely adopt an alpha helix structure? (idk) A-D-I-E-L-Y-F-H-I...
A: α-helix is a secondary structure of protein in which the polypeptide chain twists to form a helical ...
Q: 2. Several techniques were used to study the degree of translocation of truncated intermediates in t...
A: Here translocation is defined as synthesis of protein by ribosome-tRNA complex as it moves on mRNA u...
Q: HC CH reaction with HC CH lysosome .CH CH HC CH3 HC CH3 H2 HC C CH HC CH CH3 CH3 OH OH inside the ce...
A: In the lysosome, most of the glycoconjugates are degraded and monosaccharides generated by ...
Q: It refer to the structures of the pathogen that are found associated with the infected plant (i,e., ...
A: The visible effects of diseases on plants are called symptoms and any detectable changes in color, s...
Q: The allosteric regulation of ATCase by CTP is an example of: 1. Negative homotropic allostery ...
A: Enzymes are biological catalysts that aid in the speeding up of chemical reactions in living organis...
Q: Figure 1 show the shape of the peaks in gas chromatography that causes loss of column efficiency. De...
A:
Q: What are examples of polyiodides? Include their structure
A: Polyiodides are a class of polyatomic halide anions that consists entirely of iodine atoms. It is pr...
Q: I have four amino acids: serine, histidine, alanine, and tyrosine. How many different primary struct...
A: Proteins are composed of amino acids linked together by peptide linkages. T he primary structure of ...
Q: Consider the following metabolic pathway and answer the questions. CH,OPO, CHOPO, H--OH HO-C-H H-C-O...
A: Hi, thank you for posting the question on Bartleby. As per the guidelines, we can answer up to three...
Q: Use the following to answer the questions below: In each of the following multiple-choice questions,...
A: Lipids are insoluble molecules made up of carbon, hydrogen, and oxygen just as carbohydrates but in ...
Q: lease describe a strategy to correctly balance a centrifure rotor if you have 4 samples. 2 samples w...
A: Centrifuge: It is an important tool in the biochemistry lab that through a rapid spinning process u...
Q: Name some techniques/approaches (name, describe the major steps, how to analyze/interpret results) ...
A: Proteins: Proteins are polymers that contain hundreds or even thousands of amino acids that are lin...
Q: Create a Concept Map on the classification of lipids. There are two ways to classify lipid molecules...
A: Lipids: Lipids are a heterogeneous class of naturally occurring biomolecules that are soluble in o...
Q: 10. The patients with a genetically determined medium-chain acyl-CoA dehydrogenase (MCAD) deficiency...
A: MCAD (medium- chain acyl- CoA dehydrogenase) deficiency is inherited disorder which prevents our bod...
Each organism has specific gene sequence associated with it.
Given is a specific gene sequence from some organisms.
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Below is a sequence of DNA. 5'-ttaccgataattctctctcccctcttccatgattctgattaaagaaggcgagaacgaaactatttgttaatacc-3' How many "reading frames" can be identified for this sequence? How many "open reading frames" can be identified for this sequence? What is the frame of the longest ORF?In a genome project, the following genomic DNA sequences were obtained. Assemble the sequences into a contig. Using the assembled sequence, perform a BLASTn search. Does the search produce sequences similar to your assembled sequence? 5’ TCGGGGTCCTGGGATCTCATCACTGCAGCGC 3’ 5’ACTGCAGCGCTTTCCCAGCGGGCGGTGGTAC 3’ 5’GGGCGGTGGTACTCGGGAAGTCAGGAGTGTT 3’ 5’AGGAGTGTTTAAAACCTGGGGACTGGTTTTG 3’ 5’TGGTTTTGGGGGCGCTGAAGGCAGCGCAGGA 3’Given below is the DNA template. What are the gene products? 3’ TACCGGCCTATCTAGGGCCATGGCTTAATTCCC 5’ 5’ ATGGCCGGATAGATCCCGGTACCGAATTAAGGG3’
- Translate this nucleotide sequence into an amino acid sequence. Gene Sequence (5'-to-3'):…Based on these sequences, how do you decide decided which fragments were the beginning, middle, and end. Sequence ATCTTCCCTCCTAAACGTTCAACCGGTTCTTAATCCGCCGCCAGGGCCCCGCCCCTCAGAAGTTGGTSequence BTCAGACGTTTTTGCCCCGTAACAACTTGTTACAACATGGTCATAAACGTCAGAGATGGTC AATCTCTTAATGACTSequence CTACAAACATGTAAACACACCCTCAGTGGACCAACTCCGCAACATAAACCAAACACCGCTC GCGCCGAAAAAGATATGGBelow is a short nucleotide sequence from a gene. Use the Internet(e.g., see www.ncbi.nlm.nih.gov/Tools) to determine what genethis sequence is from. Also, determine the species in which thisgene sequence is found. 5’–GGGCGCAATTACTTAACGCCTCGATTATCTTCTTGC GCCACTGATCATTA–3’
- Below is a sequence of DNA.5'-ttaccgataattctctctcccctcttccatgattctgattaaagaaggcgagaacgaaactatttgttaatacc-3' How many "reading frames" can be identified for this sequence? How many "open reading frames" can be identified for this sequence? What is the frame of the longest ORF? How many codons are in the longest ORF? What is the frame of the shortest ORF? How many AA are in the shortest ORF? Using the one letter code for Amino Acids, what is the predicted AA sequence of the shortestORF (from N to C-terminal end)? Using the one letter code for Amino Acids, what is the predicted AA sequence of the longestORF (from N to C-terminal end)?Refer to the sequence below to answer the following questions. 5’- CACTTTTCAACTTGGCAGAAGCAATGTATCTCCGGATATAATCGCTTTCGAATTCG- 3’ 3’- GTGAAAAGTTGAACCGTCTTCGTTACATAGAGGCCTATATTAGCGAAACTTAAGC- 5’ Is the sequence from a bacterial or a eukaryotic cell?Identify the characteristics that support the rationale for your decision. Which DNA strand serves as the template for transcription?If you have access to the necessary computer software, make asequence file and analyze it in the following ways: What is thetranslated sequence in all three reading frames? What is the longest open reading frame? Is the sequence homologous to any known sequences? If so, does this provide any clues about the function of the sequence?
- Using the GeneEx Computer Simulation http://intro.bio.umb.edu/MOOC/jsGX/JsGenex_C2.html Complete the following Question and upload a screenshot to this assignment with your unique gene shown. (Use the Snipping Tool to capture a screenshot- it is in the start button and search for snipping tool) Design an entirely new gene that you have invented. Using the new Gene Explorer, this gene should (you can make it more challenging if you like): Produce a protein of at least five amino acids (including the N-terminal Met). Contain at least one intron. Tips 1.Use the “Enter New DNA Sequence” button and delete the starting sequence from the entry blank. 2.Type in a promoter, a little DNA, and a terminator; be sure your RNA is made. 3.Click on your gene and add the start codon, coding region, and stop codon; be sure your protein is made. Type slowly so that the program can keep up. 4. Similarly, add an intron in the coding region and be sure your gene worksBased on these sequences. Remove codons 24 to 66, inclusive. Sequence ATCTTCCCTCCTAAACGTTCAACCGGTTCTTAATCCGCCGCCAGGGCCCCGCCCCTCAGAAGTTGGTSequence BTCAGACGTTTTTGCCCCGTAACAACTTGTTACAACATGGTCATAAACGTCAGAGATGGTCAATCTCTTAATGACTSequence CTACAAACATGTAAACACACCCTCAGTGGACCAACTCCGCAACATAAACCAAACACCGCTCGCGCCGAAAAAGATATGGWhat are the advantages of using larger restriction fragments when constructing a genomic library of human DNA? Please answer asap and type your answer and do not copy from anywhere please