Boris Magasanik collected data on the amounts of the bases of RNA isolated from a number of sources, expressed relative to a value of 10 for adenine (B. Magasanik, in The Nucleic Acids: Chemistry and Biology, vol. 1, E. Chargaff and J. N. Davidson, Eds. New York: Academic Press, 1955). Amount Organism and tissue A G C U Rat liver nuclei 10 14.8 14.3 12.9 Rabbit liver nuclei 10 13.6 13.1 14.0 Cat brain 10 14.7 12.0 9.5 Carp muscle 10 21.0 19.0 11.0 Yeast 10 12.0 8.0 9.8 a. For each organism, compute the ratio of (A + G)/(U + C). b. How do these ratios compare with the (A + G)/(T + C) ratio found in DNA? Explain.

Boris Magasanik collected data on the amounts of the bases of RNA isolated from a number of sources, expressed relative to a value of 10 for adenine (B. Magasanik, in The Nucleic Acids: Chemistry and Biology, vol. 1, E. Chargaff and J. N. Davidson, Eds. New York: Academic Press, 1955). Amount Organism and tissue A G C U Rat liver nuclei 10 14.8 14.3 12.9 Rabbit liver nuclei 10 13.6 13.1 14.0 Cat brain 10 14.7 12.0 9.5 Carp muscle 10 21.0 19.0 11.0 Yeast 10 12.0 8.0 9.8 a. For each organism, compute the ratio of (A + G)/(U + C). b. How do these ratios compare with the (A + G)/(T + C) ratio found in DNA? Explain.

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter19: Genomes And Proteomes

Section: Chapter Questions

Problem 1ITD: Below is a sequence of 540 bases from a genome. What information would you use to find the...

See similar textbooks

Similar questions

Below is a sequence of 540 bases from a genome. What information would you use to find the beginnings and ends of open reading frames? How many open reading frames can you find in this sequence? Which open reading frame is likely to represent a protein- coding sequence, and why? Which are probably not functioning protein-coding sequences, and why? Note: for simplicitys sake, analyze only this one strand of the DNA double helix, reading from left to right, so you will only be analyzing three of the six reading frames shown in Figure 19.4.
Although techniques are available for determining the sequences of amino acids in proteins, it is becoming more and more common to sequence proteins indirectly by determining the base sequence of the gene for the protein and then inferring the amino acid sequence from the genetic-code relationships. Suggest why the latter technique is being used for proteins.
Shown below is a portion of a DNA sequence ( 31 base pairs long ) that encodes the last amino acids of a protein : The first three underlined base pairs indicate the frame and include the coding region . 123456789 A. Write the peptide sequence of the last 6 amino acids of the protein . Label both ends of the peptide . B. A insertion of one base pair causes the protein to decrease in length by 5 amino acids . With respect to the sequence given above , where does this insertion occur , and what base pair will you insert ? C. An change of one base pair leads to the protein to increase in length by one amino acid. With respect to the sequence given above , which base pair would you change ? How would you change this base pair for the protein to increase in length by one amino acid ?
Which of the following RNA sequences is an inverted repeat and can form a stem-loop structure? What is the correct option from the choices below? GGUAGGCAUUACGGAUGG GGUAGGCAUUAGCCUACC GAGAGAGAUUAGAGAGAG GGGGGGGAUUAGGGGGGG GAGAGUGUAAGUGUGAGA
Heinz Shuster collected the following data on the base composition of ribgrass mosaic virus (H. Shuster, in The Nucleic Acids: Chemistry and Biology, vol. 3, E. Chargaff and J. N. Davidson, Eds. New York: Academic Press, 1955). On the basis of this information, is the hereditary information of the ribgrass mosaic virus RNA or DNA? Is it likely to be single stranded or double stranded? Percentage A G C T U Ribgrass mosaic virus 29.3 25.8 18.0 0.0 27.0
Below is a polinucleotide sequence of the non-template strand of a coding DNA sequence. Use the info of this molecule as well as the attached addendum to demonstrate the flow of genetic information to protein sequence as described by the so-called “Central Dogma” . Clearly indicate the direction of your polynucleotide strands and peptide/protein. Example: (USE SPACES BETWEEN CODONS): ' XXX XXX XXX XXX ' Example: (USE SPACES BETWEEN AMINOACIDS): Polypeptide: direction-XXX-XXX-XXX-direction ATG GCA TGC AAT AGC TCA TGC b) What would happen to the amino acid sequence if the underlined nucleotide (C) would change to an A? (3
Earlier this year as part of their Twins Study, NASA issued a press release regarding preliminary results of the comparison between identical twin astronauts Scott and Mark Kelly. Scott Kelly spent a year in space (March 2015 to March 2016) aboard the International Space Station, and has spent a total of 520 days in space during his career, as opposed to a total of 54 days in space for his brother Mark. One of the ongoing investigations was the study of how space travel influences chemical changes in DNA and RNA. The researchers found that “although 93% of (Scott’s) genes’ expression returned to normal postflight, a subset of several hundred ‘space genes’ were still disrupted after return to Earth”. (A) Many mainstream media outlets reported this incorrectly by stating that Scott Kelly's genome was now only 93% identical to his brother's. What is the difference between the correct and incorrect statements? (B) Why do you think Scott Kelly experienced a 7% change in gene expression? (C)…
A small section of a gene for a protein has the following nucleotide sequence: TAT AGG GAC CTA TGT Which of the following mutations would cause a missense mutation in the sequence shown above? a. Replacement of first cytosine base with guanine base b. Replacement of final thymine base with guanine base c. Replacement of second guanine base with cytosine base d. Replacement of first thymine base with adenine base
You have sequenced the genome of the bacterium Salmonella typhimurium, and you are using BLAST analysis to identify similarities within the S. typhimurium genome to known proteins. You find a protein that is 100 percent identical in the bacterium Escherichia coli. When you compare nucleotide sequences of the S. typhimurium and E. coli genes, you find that their nucleotide sequences are only 87 percent identical.a. Explain this observation.b. What do these observations tell you about the merits of nucleotide- versus protein-similarity searches in identifying related genes?
A small section of a gene for a protein has the following nucleotide sequence: GCT CTA GCT ATC TGA Which of the following mutations would cuase a silent mutation in the sequence shown above? a. Replacement of second adenine base with thymine base b. Replacement of first thymine base with adenine base c. Replacement of second guanine base with cytosine base d. Replacement of first cytosine base with guanine base
A hypothetical base sequence of an RNA molecule is5′–AUUUGCCCUAGCAAACGUAGCAAACG–3′Make a drawing.
A molecular geneticist hopes to find a Gene in human liver cell that codes for an important blood-clotting protein,he knows that the nucleotide sequence of a small part of the Gene is GTGGACTGACA.briefly explain how to obtain gene