Briefly describe each of the following possible posttranslational protein modifications.  Give an example of each. Cross-linkage glycosylation and phosphorylation cleavage assembly into polymeric proteins (> 1 polypeptide)

Q: Define multiubiquitinylation.

A: In the cell,  proteins are degraded or modified with the help of the ubiquitin pathway. In the cell,…

Q: Compare and contrast cotranslational import of polypeptides with posttranslational import of…

A: Import of polypeptides across the membrane bilayer refers to the translocation process. The…

Q: 1 0.8 0.6 Mutant y 0.4 Wild-Type 0.2 40 60 80 [ligand] 20

A: According to the given information, the wild type protein structure has aspartate in its primary…

Q: Both hsp60-like and hsp 70 molecular chaperones share an affinity for exposed hydrophobic patches on…

A: Answer: Molecular chaperones are defined as the proteins that aid or help in the folding or…

Q: describe a detailed experimental procedure for the chemical synthesis of proteins with the…

A: Proteins are vital biomolecules that plays key role in biochemical pathways. It synthesis occurs in…

Q: Is the ubiquitination relatively stable or highly dynamic?  how does ubiquitination become detached…

A: The translation is a process through which ribosomes synthesizes polypeptide chains using mRNA. This…

Q: CAUCGGAAUAGAUCGCUAGUGGCAGGCAUAAUGAUCACCGGUCUGAGAAAAGUGGUACAUAUCAAC-5

A: Genetic codes are read in the form of triplets.first we will convert them to the triplets and then…

Q: To better understand the effects of palmitoylation on protein X, researchers want to chemically…

A: Palmitoylation is an attachment which is covalent of Palmitic acid, which is a fatty acid to…

Q: Explain the posttranslational control ?

A: Introduction Proteins are macromolecules synthesised in a cell’s cytoplasm and are made up of a long…

Q: What advantages are there for synthesizing an inactive protein that must subsequently be activated…

A: When the proteins are synthesized into naive polypeptide then these are transferred to the…

Q: Explain the type of posttranslational modification ?

A: Genes are the hereditary unit of an organism. The genes have DNA (deoxyribonucleic acid) which code…

Q: Protein X can be covalently modified with many methyl groups. What two general properties would be…

A: Note: Since you have posted multiple independent questions in the same request, we will solve the…

Q: What is the basic recognition motif to which a N-linked glycan is added? A.S/T-X-X B.KDEL…

A: Introduction N-linked Glycosylation (NLG) Is A Complicated Biosynthetic Process That Controls…

Q: 5' UGG CAA UCC UAC GAU 3' < Is it possible for a single base pair substitution to cause a truncation…

A: Yes,  it is possible for  a single base pair substitution to cause a truncation in the peptide as…

Q: The cDNA sequence for a secreted protein shows that it contains two Asn-X-Ser/Thr motifs but nothing…

A: Proteins can be post-translationally modified by attaching oligosaccharides. The glycosylation can…

Q: Explain the term posttranslational modifications?

A: Translation refer to the process in which synthesis of protein occurs from an mRNA molecule.

Q: Eukaryotic protein X has one proline residue and two cysteine residues. The proline needs to be in…

A: Eukaryotic protein : It is usually the cytoplasmic ribosomes that translate nuclear genes. several…

Q: Which anticodon would you predict for a tRNA speciescarrying isoleucine? Is there more than one…

A: A codon can be defined as the three-nucleotide sequence present on the DNA or RNA which codes for…

Q: The following triplets constitute anticodons found on a series of tRNAs. Name the amino acid carried…

A: Transfer RNA (ribonucleic acid) is a single-stranded RNA molecule that is used in the translation.…

Q: Consider the hypothetical serine protease in the image, which shows the specificity pockets. The S,…

A: Proteases:  These are enzymes that cleave peptide bonds of an amino acid chain of the protein. In…

Q: A normal polypeptide and a mutant of the polypeptide were hydrolyzed by an endopeptidase under the…

A: Chromatography is a useful technique to study the separation of amino acids. Paper chromatography is…

Q: Consider a short peptide that forms an alpha-helix within a larger protein structure. Suppose that…

A: Amino acids are the simplest units to form peptides and proteins. The amino acid sequences represent…

Q: Proteins called molecular chaperones assist in the process of protein folding. One class of…

A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…

Q: When glycoproteins are synthesized in the cell, at what stage of the polymerization of the protein…

A: Proteins with covalently linked sugar residues are known as glycoproteins. Sugars' hydrophilic and…

Q: The idea that primary sequence determines tertiary structure first came from experiments in the…

A: Proteins are the basic building blocks of life, and its biological functions are determined by their…

Q: Please draw the arrow-pushing mechanism to create the polyketide backbone chain of TYLOSIN. If two…

A: Streptomycetes, a type of soil bacterium, create the majority of polyketides, an important class of…

Q: Explain whether the specificity of lysine incorporation by lysyl-tRNA synthetase depends on tRNA or…

A: The attachment of the amino acid to the cognate tRNA is caused by the aminoacyl-tRNA synthetase.…

Q: Post-translational modifications of proteins include all the following EXCEPT a) alteration to the…

A: Translation is a process in which the RNA is translated into protein.Post translational modification…

Q: You have discovered a novel protein that has a pI = 5.5. To study the functional properties of this…

A: Isoelectric Point (pI) is a condition at a particular pH where the amino acid is present in the…

Q: If the molecule can inhibit toxic effects at 0.5mM against gastric carcinoma cells, does it mean…

A: IC 50 is half maximal inhibitory concentration which measures potency of substance to inhibiting…

Q: You have discovered a novel protein that has a pI = 5.5. To study the functional properties of this…

A: The functional properties of the new protein, has two amino acid changes—namely, a surface Phe…

Q: Once the chains of peptides that make up lysyl-tRNA synthetase protein are synthesized in ribosomes,…

A: Protein folding is the process where the proteins fold themselves to come to their native form. This…

Q: How is ubiquitination attached to the protein of interest? At which amino acid residue(s)? What…

A: Hello! Since you have posted multiple questions, we are answering only first question. If you need…

Q: Based on the N-terminal amino acid sequence, what is the approximate half-life of the protein after…

A: Introduction- N-terminal methionine cleavage plays an important role in protein synthesis in…

Q: The so-called kelch motif consists of a four-stranded β sheet, which forms what is known as a β…

A: Introduction Proteins are huge biomolecules and macromolecules that are made up of one or more long…

Q: The enzyme creatine kinase catalyzes the ATP-dependent phosphorylation of creatine. Propose a…

A: Introduction:  Creatinine is the waste product formed in muscle from a high-energy storage compound…

Q: Given that a faulty ribosomal protein is the culprit and causes DBA, discuss the possible role of…

A: The bone marrow does not create sufficient red blood cells to carry oxygen across the body in cases…

Q: How Proteins in bacteria and in eukaryotes can be posttranslationallymodified ?

A: Proteins can be easily modified by doing the addition of: Methyl groups. Phosphate…

Q: In most cases, mutations in the core of a protein that replace a smaller nonpolar side chain in the…

A: Cells have aqueous environment that is hydrophilic. So, proteins fold in a way that the hydrophilic…

Q: Read very carefully: Chymotrypsin cleaves peptides C TERMINUS to the aromatic amino acids. Trypsin…

A: Trypsin and chymotrypsin are the proteases that break down protein into individual amino…

Q: Glycosphingolipids function via cis regulation and trans recognition. Explain these terms and…

A: Introduction: Glycosphingolipids (GSLs), are a subclass of glycolipids that consists of a…

Q: Since mammalian DNA contains roughly 25% thymine residues, why do mammalian cells need a thymine-DNA…

A: Introduction: DNA is the type of nucleic acid that is present in the nucleus of the cell. It is the…

Q: 1. The following synthetic polynucleotide is synthesized and used as a template for peptide…

A: DNA is transcribed to form mRNA. The ribosome sand tRNAs translate the mRNA to form proteins. The…

Q: Predict the direction of migration for the following amino acids in solutions of the specified pH.…

A: Amino acids contain at least one alpha-amino group and one alpha-carboxylic group present in them.…

Q: Describe why this position in your protein is important and outline the effects the mutation will…

A: Any change in DNA is referred to as a mutation. Any heritable and genetic modification in the genome…

Q: A protein-ligand binding reaction is run. At equilibrium, half the protein is ligand bound, the…

A: Consider the equilibrium reversible binding interaction between a protein P and ligand L forming a…

Q: This molecule forms a dimer via pi interactions, resulting to effective molecular stacking. If the…

A: IC50 is the half maximal inhibitory concentration of a drug that is important to know the amount of…

Nucleotides

It is an organic molecule made up of three basic components- a nitrogenous base, phosphate,and pentose sugar. The nucleotides are important for metabolic reactions andthe formation of DNA (deoxyribonucleic acid) and RNA (ribonucleic acid). 

Nucleic Acids

Nucleic acids are essential biomolecules present in prokaryotic and eukaryotic cells and viruses. They carry the genetic information for the synthesis of proteins and cellular replication. The nucleic acids are of two types: deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). The structure of all proteins and ultimately every biomolecule and cellular component is a product of information encoded in the sequence of nucleic acids. Parts of a DNA molecule containing the information needed to synthesize a protein or an RNA are genes. Nucleic acids can store and transmit genetic information from one generation to the next, fundamental to any life form.