Date:Class:Name:RNA Modification QuestionsAnswer the following questions.1. What is the initial transcript called?2. What is the final messenger MRNA called?3. What two things are added to the messenger RNA?4. What fragments are removed from the messenger RNA?5. Why are the poly A tail and methyl G cap important?6. Below, on the left, are the sequences of 3 pre-mRNAs. The exons are underlined and the introns are notunderlined. Draw themature mRNA's (ready to leave the nucleus) below each pre-mRNA.a. AUGGGGCCCAAACCCCAGUUUUAAb. AUGCAGUUGUUACGCCAAGGCCCGCGCGAUAGc. AUGUCAUGUAUCAUGUAUGUAUGUAUGUAUGUAGUAUGUAGUAUGUUUGUAUAAA(C) 2015 Bethany Lau.

Name: Date:Class:Name:RNA Modification QuestionsAnswer the following questi
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Date:Class:Name:RNA Modification QuestionsAnswer the following questions.1. What is the initial transcript called?2. What is the final messenger MRNA called?3. What two things are added to the messenger RNA?4. What fragments are removed from the mes

# According to our guidelines we can answer only first 3 subparts or in case of short type questions…

Science

Biology

Class: Name: RNA Modification Questions Answer the following questions. 1. What is the initial transcript called? 2. What is the final messenger mRNA called? 3. What two things are added to the messenger RNA? 4. What fragments are removed from the messenger RNA? 5. Why are the poly A tail and methyl G cap important?

Class: Name: RNA Modification Questions Answer the following questions. 1. What is the initial transcript called? 2. What is the final messenger mRNA called? 3. What two things are added to the messenger RNA? 4. What fragments are removed from the messenger RNA? 5. Why are the poly A tail and methyl G cap important?

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter15: From Dna To Protein

Section: Chapter Questions

Problem 12TYK: Discuss Concepts The normal form of a gene contains the nucleotide sequence: When this gene is...

See similar textbooks

Similar questions

Refer to the DNA sequence provided: 3’ -TACTGAAGCGGCAGCCCCGCATGAGTAGACCTTACT-5’ a. What is the mRNA transcript of the anticoding strand of the DNA model? b. What is the amino acid sequence of the polypeptide chain that will be translated from the mRNA in (a)?
The pre-mRNA transcript and protein made by several mutant genes were examined. The results are given below. Determine where in the gene a likely mutation lies: the promoter region, exon, intron, cap on mRNA, or ribosome binding site. a. normal-length transcript, normal-length nonfunctional protein b. normal-length transcript, no protein made c. normal-length transcript, normal-length mRNA, short nonfunctional protein d. normal-length transcript, longer mRNA, shorter nonfunctional protein e. transcript never made
A normal mRNA that reads 5’ - UGCCAUGGUAAUAACACAUGAGGCCUGAAC- 3’ has an insertion mutation that changes the sequence to 5' -UGCCAUGGUUAAUAACACAUGAGGCCUGAAC- 3’. Translate the original mRNA and the mutated mRNA, and explain how insertion mutations can have dramatic effects on proteins. (Hint: Be sure to find the initiation site.)
An unprocessed pre-mRNA has the following structure. Which of the following is not a possible size (in bp) of the mature mRNA? 205bp 180bp 150bp 100bp
Discuss Concepts The normal form of a gene contains the nucleotide sequence: When this gene is transcribed, the result is the following mRNA molecule: In a mutated form of the gene, two extra base pairs (underlined) are inserted: What effect will this particular mutation have on the structure of the protein encoded in the gene?
What processing step enhances the stability of pre-tRNAs and pre-rRNAs? methylation nucleotide modification cleavage splicing
Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:
Give typing answer with explanation and conclusion to all parts Consider the following DNA mRNA sequence: 5’-ACTGATCCATGCCAGGGGTTTTCAACTAAAATGAAA-3’ a) What is the template sequence this mRNA was transcribed from? Include 5’ and 3’ labels. b) Based on this sequence, what you predict would be the resulting peptide sequence from it. c) In examining this sequence what is the proper reading frame of the open reading frame? (+1, +2, +3, -1, -2, or -3). d) What would you predict the peptide sequence to be if there was the following mutation that led to a base change: 5’-ACTGATGCATGCCAGGGGTTTTCAACTAAAATGAAA-3’
1. If the gene above is transcribed into a functional mRNA, a.) how many codons will be carried by the functional mRNA? b.) what is the sequence of the 25th codon? c.) what is the sequence of the stop codon? 2. If the mRNA transcribed for this gene will be translated into a functional protein, a.) how many amino acids will be used to build the polypeptide chain? b.) what is the amino acid coded by the 25th codon? c.) what is the amino acid coded by the last codon? 3. If the above gene is one of the three structural genes of the lac operon that codes for the protein/ enzyme responsible for breaking lactose into two molecules of simple sugars, a.) what triggers the activation of this gene? b.) what triggers the inactivation of this gene? c.) what substance is attached to the operator region of the operon in the absence of activator? d.) what gene is responsible for the synthesis of the substance used to attach in the operator region in the absence of activator? e.) what…
1. If the gene above is transcribed into a functional mRNA,a.) how many codons will be carried by the functional mRNA?b.) what is the sequence of the 25th codon?c.) what is the sequence of the stop codon?2. If the mRNA transcribed for this gene will be translated into a functional protein,a.) how many amino acids will be used to build the polypeptide chain?b.) what is the amino acid coded by the 25th codon?c.) what is the amino acid coded by the last codon?
1. For the genotypes and conditions (lactose present or absent) shown in the following table predict whether functional enzymes, nonfunctional enzymes, or no enzymes are made. 2. Even though the LacZ,Y and A structural genes are transcribed as a single polycistronic mRNA, each gene contains the initiation and termination signals essential for translation. Predict what will happen when a cell growing in the presence of lactose contains a deletion of one nucleotide early in the Z gene and early in the A gene.
Consider this short mRNA: 5’ – AUGGCAGUGCAA – 3’. Answer the following questions assuming the code is non-overlapping. How many codons are represented in this oligonucleotide? If the second G were changed to a C, what would be the resulting amino acid?