Choose one 10 6. When you move up an energy pyramid, the amount of available energy by %. Therefore, producers would have the choose :nergy, while tertiary coChoose one decreases increases e Choose energy 7. Label the tropic levels on the pyramid:

Q: Please help me answer questions 79 and 82 79. How do CAM plants minimize photorespiration? A.…

A: 79. CAM stands for Crassulacean Acid Metabolism and it is a mechanism of photosynthesis involving…

Q: Leo was taking angiotensin converting enzymes inhibitor or what is known as ACE inhibitor; this…

A: The renin–angiotensin–aldosterone system (RAAS) is a critical regulator of blood volume and systemic…

Q: Equipment or materials used in immobilizing and separating cells of streak, pour and spread method.

A: Answer :- We need to understand one by one are as follow :-  * Equipment or materials used in…

Q: In most populations, population size remain near the carrying capacity as long as limiting factors…

A: Limiting resources are considered as the carrying capacity for any population.

Q: Please use the following scenario to answer questions 1-4

A: The question is related to Hardy Weinberg Equilibrium. p is the dominant allele. q is the recessive…

Q: Which of the following represents an accurate pathway of energy transfer through trophic levels of…

A: Energy transfer In the trophic levels the energy transfers from the producers to the consumers. In a…

Q: Name the type of mutation from the following choices: silent, missense, nonsense, frameshift. The…

A: CGA codes for Arginine.  GGA codes for Glycine.  Since the protein being coded for is completely…

Q: Assignment in Modules 4-6 Matching Type: Match Column A with Column B. Type the answer before the…

A: 1) phenylketonuria is the genetic defect in which the child is unble to breakdown the protein called…

Q: Which of the following is NOT a true statement? Action potentials are generated only when a neuron…

A: There are few important points that should be kept in mind: Neurons possess electrical excitability…

Q: What causes allele frequencies to differ between biological populations?

A: Allele  frequency  Allelic frequency can be defined as relative frequency of an allele at a…

Q: Give economic and ecological significance of Rice (Oryza)

A: Rice (Oryza sativa) is a grain and food. It is swamp grass by nature. It is a staple meal in many…

Q: Question 16 The fact that some eukaryotic FRNAS are self-splicing indicates that (A RNA can contain…

A: Nucleus is main controller of the cell which possess genetic information . It also contain long…

Q: Match the letter to the appropriate bone. Im A d Im

A: Introduction:- The core framework of body is the skeletal system.It is composed of bones as well as…

Q: what are evidences that indivate plants are measuring the length of the night?

A: Introduction  The physiological response of organisms to the length of night or a dark period is…

Q: . In order for a phage to infect the host bacterium, it is preferred that the cell wall is newly…

A: In order for a phage to infect the host bacterium, it is preferred that the cell wall is newly…

Q: How does the oocyte nucleus move during oogenesis?

A: Oogenesis: Otherwise called as ovogenesis. This is a process that happens during the embryonic…

Q: ATP synthase is a protein that catalyzes the formation of the energy storage molecule adenosine…

A: Given: ATP synthase is the protein that catalyzes the formation of the energy storage molecule…

Q: Do you think that Leo needs to drink more water prior to his exercise? Explain why?

A: Dialysis is a technique to eliminate byproducts and excess liquid from the blood when the kidneys…

Q: Why do some scientists use immersion fluids when looking at their microscope slides? Increases the…

A: One of the problems in light microscopy is to overcome the limits of the optical resolution and…

Q: role of the nervous system and genes in intellectual intelligence?

A: The neural system, often known as the "nervous system," is a complex network of neurons that have…

Q: What are the environmental climatic and bio-physical requirements of lowland rice

A: Answer :- Rice crop needs a hot and humid climate. It is the most appropriate to districts which…

Q: the adaptations that Orobanchaceae (plant) has evolved to invade and manipulate the hosts (talk…

A:

Q: Which theory of aging states that unstable oxygen molecules tend to steal electrons as they bounce…

A: The unstable oxygen molecules have higher energy and can damage the biomolecules.

Q: happens when traits become more common in a population because of the reproductive success of…

A: Mechanical isolation is defined as the physical incompatibility between the reproductive organs of…

Q: Please help Why did we use nanoparticles?

A: Nanoparticles are the techniques which are used in the biotechnology which used to identify the gene…

Q: A researcher wants to cut this piece of linear DNA. 5 AGCTAGTCCGGATCCGAGGGCCCTTCTCATGAGATCCGGATGACC…

A: The discovery of restriction enzymes in 1968 by Swiss scientist "Werner Arber" ushered in the era of…

Q: 9. Explain how a small amount of growth factor can mediate an amplified signal inside the cytoplasm…

A: Signal transduction pathways translate signals received at the cell's surface into cellular…

Q: 4. 16B (Eukaryotes): Describe 4 factors that differentiate eukaryotic chromosomes/genome from a…

A: Nucleus is a chief controller of the cell which carries genetic instructions . It comprises of…

Q: In his discussion of ethics and the environment, Velasquez concludes that Select one or more than…

A: Manuel Velasquez is a business ethics professor who also teaches about the societal, legal, and…

Q: 5. What happens to the population density in a declining po a. It decreases. b. It increases. c. It…

A: Population density can be calculated by three different methods they are arithmetic, physiological…

Q: Explain the neutral theory of molecular evolution (20%) and how you use it as a null hypothesis to…

A: There are multiple evolutionary terms that helps in establishing a role in the molecular evolution.…

Q: List 3 species of bacteria that can spoil milk and indicate how they react to the gram staining…

A: Spoilage of milk and milk products results from growth of fermentative bacteria when storage…

Q: 26. Is pyruvate being oxidized or reduced during stage 2? How can you tell? (What do you see in this…

A: NOTE: Since you have posted a question with multiple subparts so we will be solving the first three…

Q: You have a photoreceptor cell in a dish. You are recording its membrane potential while flashing…

A: Answer :- Option (B) is correct. - The cell depolarizes, with brighter light causing more…

Q: What is composite materials? Describe biomass derived composite materials by picking one biomass.

A: INTRODUCTION Biomass refers to the mass of living beings such as plants, animals, and microbes, as…

Q: What is biomass

A: Biomass is defined as the total quantity of plants in a particular area.

Q: Dihybrid Crosses - Problem 1 I IHINK WE WERE IN THE BATH TOR TO0 LONGI WE'LL STICK WITH PEAS FOR THE…

A: Alleles are the alternative forms of a gene that are located on the same locus of a homologous…

Q: What are initiatives that have to be done lower your household’s vulnerability to climate change

A: Environmental change drives have huge scope efforts to battle an Earth's global warming temperature…

Q: If you cloned GFP under the control of the V. fischeri Lux promoter, when would you see GFP…

A: Vibrio fischeri exhibits bioluminescence only when the density of its cell is higher and…

Q: Which of the following true of active immunity? Is considered to provide short term protection O…

A: Ans: Active immunity results when the exposure to disease organism stimulate the immune system to…

Q: Capacity to carry oxygen by sickle cell hemoglobin is reduced due to

A: Sickle cell disease is a group of disorders of blood generally inherited from  parents to their…

Q: Styles raph Lungfishes Amphibians Mammals Tetrapod limbs Lizards and snakes Amnion Crocodiles…

A: A tree like or comb like taxonomic relationship among different group of organisms is called…

Q: Please help me with questions 1 & 2 1. In photosynthesis, the carbon in CO2 is ______ to form…

A: Photosynthesis is the physiochemical process.

Q: Central self-tolerance in the immune system arises when maturing T cells in the thymus undergo…

A: Apoptosis is a process of natural cell death. T cells are matured in Thymus but are born in Bone…

Q: Please help Why did we use biodegradable nanoparticles? Please use The worksheet below and don’t…

A: Biodegradable Nanoparticles (BNPs) are basically particles with matter of interest (such as gene…

Q: During activation, there is a secondary exchange of signals between the presenting cell & activated…

A: During activation , there is a secondary exchange of signal between presenting cell and…

Q: In certain regions, monk seals overturn rocks to catch prey underneath. But nearby sharks often…

A: Introduction Ecological interactions:- It is the relationship between two different or the same…

Q: Please give an example of an experiment that can find out if your protein of interest is over…

A: Expression analysis refers to the techniques, that can detect the the expression of different genes…

Q: Explain why this statement is true, using phylogenetic and morphological evidence. Tunicates…

A: Tunicates are transparent or brilliantly colored marine animals that are found on the dock pilings,…

Q: Describe three components of an Adaptive Radiation.

A: Adaptive radiation is the process by which individuals in a rapidly diversifying group diverge from…

Ecological adaptations

An ecological adaptation is any morphological, physiological, or behavioral trait of an organism that allows it to survive and reproduce in a habitat or ecosystem. Adaptation is a biological mechanism by which an organism gradually gets more acclimated to its surroundings.