Choose the answer that has these events of protein synthesis in the proper sequence. (Note some steps may be missing) A peptide bond forms A small ribosomal subunit binds with the mRNA. The tRNA leaves the P site, and the ribosome translocates to the P site. The Methionine initiator-tRNA binds to the start codon. An incoming amino-acyl tRNA binds to the A site The large ribosomal subunit binds the small subunit Group of answer choices A 4, 1, 2, 5, 6, 3 B 2, 4, 6, 5, 1, 3 C 1, 3, 2, 4, 5, 6 D 4, 1, 3, 2, 5, 6 E 5, 4, 3, 2, 6, 1

Choose the answer that has these events of protein synthesis in the proper sequence. (Note some steps may be missing) A peptide bond forms A small ribosomal subunit binds with the mRNA. The tRNA leaves the P site, and the ribosome translocates to the P site. The Methionine initiator-tRNA binds to the start codon. An incoming amino-acyl tRNA binds to the A site The large ribosomal subunit binds the small subunit Group of answer choices A 4, 1, 2, 5, 6, 3 B 2, 4, 6, 5, 1, 3 C 1, 3, 2, 4, 5, 6 D 4, 1, 3, 2, 5, 6 E 5, 4, 3, 2, 6, 1

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter13: Gene Expression

Section13.4: Translation

Problem 3C: A certain mRNA strand has the following nucleotide sequence: 5AUGACGUAUAACUUU3 What is the anticodon...

See similar textbooks

Similar questions

A certain mRNA strand has the following nucleotide sequence: 5AUGACGUAUAACUUU3 What is the anticodon for each codon? What is the amino acid sequence of the polypeptide? (Use Figure 13-5 to help answer this question.) Figure 13-5 The genetic code The genetic code specifies all possible combinations of the three bases that compose codons in mRNA. Of the 64 possible codons, 61 specify amino acids (see Figure 3-17 for an explanation of abbreviations). The codon AUG specifies the amino acid methionine and also signals the ribosome to initiate translation (start). Three codonsUAA, UGA, and UAGdo not specify amino acids; they terminate polypeptide synthesis (stop).
Sequence the following steps in protein synthesis from first to last. Write only the numbers (1-6) on space provided for; ____a. transcription ____b. tRNA amino acid ____c. amino acids separate from tRNA ____d. polypeptide chain assembled ____e. mRNA links to ribosome ____f. stop codon encountered in mRNA
Match each term with the most appropriate description. sites for polypeptide assembly binds to ribosomes to begin translation a tRNA triplet complementary to a mRNA codon complex with proteins to form ribosomes
Number the following steps of protein synthesis in the order in which they occur, starting with 1 and ending with 9.a. _____ The stop codon is reached, and the polypeptide is released.b. _____ The small ribosomal subunit finds the start codon, and the large ribosomal subunit joins.c. _____ The end of the gene is reached, and the pre-mRNA is released and then edited.d. _____ The transcription factor binds the promoter.e. _____ The protein is folded and modified to become functional.f. _____ RNA polymerase builds the mRNA transcript.g. _____ mRNA and initiator tRNA bind the small ribosomal subunit.h. _____ New tRNA molecules are brought into the A site successively, and the peptide chain of the tRNA in the P site is joined to the amino acid of the tRNA in the A site.i. _____ mRNA exits the nucleus via a nuclear pore.
Number the following steps of protein synthesis in order in which they occur, starting with 1 and ending with 9. a. ____ the stop codon is reached, and the polypeptide is released b.____ the small ribosomal subunit finds the start codon, and the large ribosomal subunit joins. c.____ the end of the gene is reached, and the pre-mRNA is released and then edited. d. ____ The transcription factor bonds the promoter. e. ____ the protein is folded and modified to become functional. f. ____ RNA polymerase builds the mRNA transcript. g. ____ mRNA and initiator tRNA bind the small ribosomal subunit. h. ____ new tRNAs are brought into the A site successively, and the peptide chain of the tRNA in the P site is joined to the amino acid of the tRNA in the A site. i. ____ mRNA exits the nucleus via a nuclear pore.
Which statement is true of the translocation phase of elongation during protein synthesis? a. The empty tRNA moves to the A site of the ribosomal complex. b. The empty tRNA moves to the T site of the ribosomal complex. c. The dipeptide moves from the A site to the P site of the ribosomal complex. d. The dipeptide moves from the P site to the A site of the ribosomal complex.
A particular tRNA is mutated so that the amino acid attachment cannot bind with the aminoacyl-tRNA synthase. What happens when an mRNA transcript contains the codon for this tRNA? A. The tRNA will not bind to this codon. B. Translation stops and the protein is released. C The wrong tRNA is added to the protein chain. D. Translation stops and the protein remains bound to the ribosome.
Directions:Sequence the following steps in protein synthesis from first to last. Write only thenumbers (1-6) on space provided for; ____a. transcription____b. tRNA amino acid____c. amino acids separate from tRNA____d. polypeptide chain assembled____e. mRNA links to ribosome____f. stop codon encountered in mRNA
Which of the following steps in protein synthesis does not require a direct supply of energy? a. proofreading step by certain aminoacyl-tRNA synthetases b. translocation of mRNA in a ribosome c. linkage of an amino acid to its cognate tRNA d. alignment of a tRNA anticodon with an mRNA codon
Use the table to answer: A portion of an mRNA attached to a ribosome reads: 5′ GACCAUUUUGACAAAGUUGUAGUGUGGGUAGGGUGA 3′ If a tRNA with a Phe attached is in the P site of the ribosome, an uncharged tRNA will be present in the E site that delivered which amino acid? What is the last amino acid in this polypeptide? Which amino acid will be the most frequent in the polypeptide?
C. Sequence the following steps in protein synthesis from first to last (1-6)___A. Transciptions___B. tRNA - amino acid unite link to mRNA___C. Amino acid separate from tRNA ___D. Polypeptide chain assembled ___E. mRNA links to ribosome___F. Stop codon encountered in mRNA
For each of the following, identify the type of RNA involved (mRNA, rRNA, or tRNA). a. Transports the correct amino acid to the ribosome, using the information encoded in the mRNA. b. Is a major component of ribosomes. c. Speciﬁes the order of amino acids in a protein, using a series of three-base codons, where different amino acids are speciﬁed by particular codons. d. Contains a three-base anticodon that pairs with a complementary codon revealed in the mRNA. e. Assists in making the bonds that link amino acids together to make a protein.