Consider a peptide with the following amino acid sequence: H2N-ASENHLDGCPYTKSRG-COOH Analyze the predominate protonation state and thus dominate charge (+1, 0, -1) of the residues in this peptide at pH 3, 6, and 10 by filling in the table below, identifying the relevant pKa appropriate for each residue. (Note that choice of pKa and its. application will be graded independently; e.g., if you can choose the wrong pKa but apply it correctly, you will lose points only for the pKa.) AA Residue pKa Charge pH 3 Charge pH 6 Charge pH 10 A S E N H L D G C P Y T K S R G

Consider a peptide with the following amino acid sequence: H2N-ASENHLDGCPYTKSRG-COOH Analyze the predominate protonation state and thus dominate charge (+1, 0, -1) of the residues in this peptide at pH 3, 6, and 10 by filling in the table below, identifying the relevant pKa appropriate for each residue. (Note that choice of pKa and its. application will be graded independently; e.g., if you can choose the wrong pKa but apply it correctly, you will lose points only for the pKa.) AA Residue pKa Charge pH 3 Charge pH 6 Charge pH 10 A S E N H L D G C P Y T K S R G

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter3: Biological Macromolecules

Section: Chapter Questions

Problem 33CTQ: Aquaporins are proteins embedded in the plasma membrane that allow water molecules to move between...

See similar textbooks

Chemistry

Consider a peptide with the following amino acid sequence:

H₂N-ASENHLDGCPYTKSRG-COOH

Analyze the predominate protonation state and thus dominate charge (+1, 0, -1) of the residues in this peptide at pH 3, 6, and 10 by filling in the table below, identifying the relevant pKa appropriate for each residue. (Note that choice of pKa and its. application will be graded independently; e.g., if you can choose the wrong pKa but apply it correctly, you will lose points only for the pKa.)

AA Residue	pKa	Charge pH 3	Charge pH 6	Charge pH 10
A
S
E
N
H
L
D
G
C
P
Y
T
K
S
R
G

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Similar questions

Question for protein crystallography- 1. While performing a routine protein crystallization screening, you observe that one of your well drops has doubled in size compared to the remaining wells. Note: the drop in question was set up by taking 1 µL of the protein solution (10 mg/mL LDH in 20 mM TRIS pH 7.5, 0.5 M NaCl and 10% PEG 4000K) and adding it to 1 µL of the crystallization solution (10% PEG 4000K, 50 mM NaCl and 20 mM TRIS pH 8.0). Why did this drop grow larger in size compared to when you initially set it up?
384 Peptides & X-ray/NMR Methods Q4.2- Describe one advantage and one disadvantage of trying to solve molecular protein structures by 1) X-ray crystallography and by 2) Nuclear Magnetic Resonance (NMR) spectroscopy.
MATHEMATICAL Calculate the isoelectric point of each of the following amino acids: glutamic acid, serine, histidine, lysine, tyro- sine, and arginine.
QUESTION What is the net charge on Peptide (PIMF ) at a pH of 14?
THOUGHT QUESTION Imagine we identify a gene that is directly responsible for the effects of vasopressin on male mammals, including humans-we will call it trust1-that leads to the production of a vasopressin receptor in the brain, which we will call TRUST1. There are different versions of trust1, all of which lead to different levels of the behavior associated with this neuropeptide on male behavior. Give some examples where it would be a good idea to know a particular males genotype-that is, which of the trust1 genes he has. Give an example of when you think science has gone too far and this information should not be known.
REFECT AND APPLY Write equations to show the ionic dissociation reactions of the following amino acids: aspartic acid, valine, histidine, serine, and lysine.
20. The dissociation constant of protein Z for ligand Y is: 10 micromolar. What fraction of the ligand is bound at ligand concentration = 5 micromolar?
1CFD CALCIUM-FREE CALMODULIN How long is the protein’s primary sequence?Does this protein have any secondary, tertiary and/or quaternary structures present?Are there any molecular additions to this protein that are not amino ac
GTTTTCACTGGCGAGCGTCATCTTCCTACT 10. Generate a secondary structure prediction for one identified protein.
68. In animal cells, enzymes synthesized to hydrolyze polymers to form monomers. This process involves the RER, the SER and the Golgi apparatus. In which of the following is the molecule listed for this process employed by the cells of the organ indicated? a) formation of Fatty acids by lipases in the small intestine. b) production of glucose from glycogen by the liver. c) formation of amino acids by proteases in the small intestine d) formation of monosaccharides by Carboxylases in the mouth and small intestine. e) all are possible
GABA (B) protein Need help answering questions about the GABA(B) protein. What is the primary structure Describe secondary structure (alpha-helix, beta sheet, and how many of each and what percent of the total protein)What is the tertiary structure (which should also show secondary structure)Does the protein have a quaternary structure, if so what is it?
Please ASAP. Thank you. How does the mutation change/affect the structure of the Hb heterotetramer (ie how is quaternary protein structure affected)?