Use the diagram of a gene below to answer the question. The site of transcription initiation of thegene is indicated by the arrow.5'DWhich letter in the diagram above best corresponds to the location where exons are found?O ACNone of these correspondDB.

The method of producing RNA copies of a genetic sequence is known as transcription. This duplicate,…

Answered: D. Which letter in the diagram above…

D. Which letter in the diagram above best corresponds to the location where exons are found? O A O C O B O None of these correspond O D

BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)

10th Edition

ISBN:9781305967359

Author:STARR

Publisher:STARR

Chapter9: From Dna To Protein

Section: Chapter Questions

Problem 16SA

See similar textbooks

Related questions

Q: G C T A T A A T G G C A a a a t t g G G T C A G G C A a a t c g a C A T A G C T G A C G G g g a t g…

A: Dna is read in 5 ' to 3 ' direction and the mrna is read by the trna in the form of genetic code by…

Q: DNA DNA Complimentary MRNA sequence tRNA sequence Amino acid code Strand А T A А А G T А T T T A G

A: Assuming the given sequence is sense strand of the DNA. The sense strand is in the direction 5’-3’.…

Q: omplete what is being asked and finally with the Genetic Code table, determine what specific amino…

A: Biological macromolecules are those large molecules that are necessary for the survival and growth…

Q: 3. An alteration of genetic information is shown below. A-G-T-A-C-C-G-A-T → A-G-T-G-A-T What type of…

A: Alteration of genetic information shown below is an example of Deletion Mutation. In the given…

Q: Refer to the Table of the Genetic Code and match the type of mutation to the following codon changes

A: Mutation : A mutation is defined as the changes in the nucleotide sequence. These results in…

Q: Each of these six terms fits into one (and only one) of the following blanks: bases, proteins,…

A: Gene regulation involves cellular processes that control the rate and manner of gene expression. A…

Q: If the sequence of amino acids encoded by a strand of DNA is serine-alanine-lysine-leucine, what is…

Q: Compare and contrast the roles of introns and exons.

A: Introduction A genome is consists of transcriptionally active genes. These genes form mRNA as they…

Q: b) Draw a diagram to show how nucleotides are organised in the structure of DNA. Note: You need only…

A: The four most important biomolecules in living things are carbohydrates, amino acids, lipids, and…

Q: Indicate if each term/description applies to only DNA, only RNA, or to both DNA and RNA.

A: Indicate if each term/description applies to only DNA, only RNA, or to both DNA and RNA. Consists…

Q: For each of the following sequences, fill in either the DNA, the MRNA sequence, or the amino acid…

A: The central dogma is referred as the central processing system which includes the transfer of…

Q: Classify the type of mutation that have taken place: silent, missense and nonsense as a result of a…

A: The mutation occurs when there is a change in the nucleic acid sequence. These mutations could be…

Q: 1. Label the diagram below with the following terms: O DNA Ribosome MRNA Transcription tRNA…

A: Transcription and translation are the components of gene expression. These two processes are known…

Q: 3. Understand Reverse/forwards strands and reverse complementary strand Example sequence…

A: Transcription is the process by which the nucleotide sequence of the DNA (deoxyribonucleic acid) is…

Q: Anticodons pair with_____ . a. mRNA codons c. RNA anticodons b. DNA codons d. amino acids

A: Translation is the process by which proteins are formed in the cytoplasm using ribosomes and mRNA.…

Q: 2) If there were 75 naturally occurring amino acids then what is the smallest codon size? A) 1 B) 2…

A: A codon is a trinucleotide sequence of DNA or RNA that corresponds to a specific amino acid or stop…

Q: D) Draw the first two (2) base pairings of the DNA molecule from the 5' end and label all key…

A: The self replicating biomolecules that are present in the chromosomes and carry genetic information…

Q: b) For a DNA strand with the given genetic code of bases , undergoing transcription, what will be…

A: The central dogma of molecular biology is the synthesis of mRNA and polypeptide chain by…

Q: ribe the crucial role of base pairing between codon and anticodon.

A: The hereditary material translated into messenger RNA is expressed by the triplet code (mRNA). The…

Q: Which of the following statements below is incorrect? * A. the genetic code is overlapping B.…

A: As per guidelines, you have asked multiple questions we will solve the first question for you. If…

Q: 2. Identify the following structures when given images such as the ones below: ● process of…

A: Introduction The cell is the basic structural and functional unit of life present in all living…

Q: Protein synthesis is a complicated process involving DNA being transcribed to RNA, which is then…

A: Protein synthesis is a complicated process involving DNA being transcribed to RNA, which is then…

Q: HN. `NH NH H2N° A. В. Consider the 3 structures shown. Which of these is (normally) NOT present in…

A: Nucleic acids are the major class of biomolecules that are important for all forms of the organism.…

Q: b) For a DNA strand with the given genetic code of bases , undergoing transcription, what will be…

A: The central dogma of molecular biology is the synthesis of mRNA and polypeptide chain by…

Q: 3. Consider the following diagrams representing three different DNA molecules. (a) 5' w 3' 3' 5' (b)…

A: DNA polymerase is an enzyme that catalyzes the synthesis of DNA from nucleotide…

Q: PART C. Use your codon chart to determine the amino acid sequence. Remember to read through the…

A: the three-letter genetic code is the way by which the cell transcript the information from DNA to…

Q: d. In the given segment, illustrate and indicate the direction of synthesis of: 1. a 5-nucleotide…

A: we are answering D part E part is missing pls repost for E part.

Q: Compare and contrast exons and introns

A: Introduction - Noncoding regions of an RNA transcript or the DNA encoding it that are spliced off…

Q: is the term used to describe the genetic code because a codon specify only for one amino acid is the…

A: 1. The genetic code is UNAMBIGUOUS i.e., each triplet ( codon) specifies only a single amino acid.…

Q: SPLIT DNA mRNA TRNA Codon Anticodon Amino Acid A T C G G C A T A G T A A

A: The DNA is the genetic material that is responsible for the production of RNA transcription process.…

Q: Using a codon table, complete the DNA triplets, mRNA codons, tRNA anticodons, and amino acids in the…

A: Genetic code is in triplets and the codes are read by the anticodon and thus the amino acids are…

Q: (a) Provide the sequence of the DNA complementary to the following strand (please write it in the 3'…

A: Complementary DNA Complementary DNA (cDNA) could be a DNA copy of a mRNA (mRNA) molecule created by…

Q: Determine what amino acid will be formed from the given DNA strand below:…

A: Determine what amino acid will be formed from the given DNA strand below:…

Q: Which of the following is an example of the degeneracy of the genetic code? Group of answer choices…

A: Answer of the question given below...

Q: 2. (a) Consider Amino Acid Sequence 2. How is Amino Acid Sequence 2 different from Amino Acid…

A: The explanation is given below.

Q: Discuss the difference between intron and Exon

A: Exons are named as nucleic acid coding successions & they are available in mRNA. Introns are…

Q: Illustrate the process of transcription by providing the correct bases for mRNA strand given the DNA…

A: Transcription is the process where the genetic information on the DNA strand is transferred into an…

Q: DNA strand below: 3’ T A C A T G C C G A A T G C C 5’ Discuss how will replication happen by…

A: Introduction: DNA stands for 'deoxyribonucleic acid' and it is the hereditary material in humans and…

Q: start codon and stop codon

A: The transcription is the process in which the mRNA copied information from DNA for protein…

Q: Which mutation changes a normal codon to another codon specifying the same amino acid a. directed b.…

A: In missense mutation codon for an amino acid gets replaced. Then option b is wrong.

Q: DNA DNA Complimentary MRNA sequence tRNA sequence Amino acid code Strand A т G А A A G T А T т T А G

A: Gene expression is the process by which the information from a gene is used in the synthesis of a…

Q: d. Which amino acid is represented by (6)? e. Give the one anticodon in the 5' to 3' direction that…

A: In this question, we are shown the process of protein formation from a DNA sequence. This takes…

Q: Name some subtopics for introns and exons.

A: INTRODUCTION Introns and exons are nucleotide sequences within a gene. Introns are removed by RNA…

Q: transcribe the following DNA strand into mRNA and translate that strand into a polypeptide chain,…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: Given the following DNA strand: TACAGAGATAACCGAATT A. Write the corresponding strand that would…

A: Introduction Deoxyribonucleic acid, or DNA, is a molecule that holds the instructions that allow an…

Q: 10.9 the beginning of a gene and five different mutations of this the base-pairing rules to complete…

A: A "nucleic acid" is a linear polymer of nucleotides that is a component of the cell's information…

Q: Which of the following carries amino acids?

A: Ribonucleic acid (RNA) is a single stranded nucleic acid found in all living cells. Its different…

Concept explainers

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.

Question

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1 Introduction

VIEW

Step 2 Answer

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Energy that drives transcription is provided mainly by _______ . a. ATP c. GTP b. RNA nucleotides d. RNA polymerase
Use the diagram of a gene below to answer the question. The site of transcription initiation is indicated by the arrow. Which letter best corresponds to the location where alternative proteins can be produced from the same gene?
Compare and contrast the process of transcription and translation in prokaryotes then describe transcription unit.
Use the table to answer: A portion of an mRNA attached to a ribosome reads: 5′ GACCAUUUUGACAAAGUUGUAGUGUGGGUAGGGUGA 3′ If a tRNA with a Phe attached is in the P site of the ribosome, an uncharged tRNA will be present in the E site that delivered which amino acid? What is the last amino acid in this polypeptide? Which amino acid will be the most frequent in the polypeptide?
Refer to the figure to answer these questions:a. Add labels for mRNA (including the 5′ and 3′ ends) and tRNA. Inaddition, draw in the RNA polymerase enzyme and the ribosomes,including arrows indicating the direction of movement for each.b. What are the next three amino acids to be added to polypeptide b?c. Fill in the nucleotides in the mRNA complementary to thetemplate DNA strand.d. What is the sequence of the DNA complementary to the templatestrand (as much as can be determined from the figure)?e. Does this figure show the entire polypeptide that this geneencodes? How can you tell?f. What might happen to polypeptide b after its release from theribosome?g. Does this figure depict a prokaryotic or a eukaryotic cell? How canyou tell?
describe the process of transcription of DNA based off of these figure
In this diagram, the position marked "A" corresponds to the _____ end of a new RNA molecule (shown in yellow) that is being transcribed, base paired with the ______ strand of a DNA molecule (shown in red).
Write out the complementary mRNA strand that would pair with the following
Which rRNA plays a major role in the aligning of the transcript in the ribosome of prokaryotes? A. 28S rRNA B. 23S rRNA C. 16S rRNA D. 18S rRNA
Which is the mRNA molecule that would be transcribed from this DNA template: TGGCAAGTACGT answer choices A.) ACCGUUCAUGCA B.) UCCGUUCUUGCU C.) ACCGTTCATGCA D.) UGGCAAGUACGU
Give typing answer with explanation and conclusion to all parts The pairing of the U1 snurp and the donor site signals what particular event? A. Identify the donor splice site. B. Identify/recognize intron. C. Keep the U6 RNA free from binding to the U1 RNA. D. Base pair with the nucleotides in the Branch site. E. De-branch the lariat and release the intron.
Choose the combination of answers that most accurately completes the statement.The function of ligase is to a. rejoin segments of DNA c. synthesize cDNA b. make longitudinal cuts in DNA d. break down ligaments