DNA (a) 0.5 μη (b) 1.3 µm FIGURE 3.42 The Chromosome (a) Escherichia coli undergoing cell division, with the DNA shown in red (TEM). (b) Chromosome released from a gently lysed E. coli cell (TEM). Consider how tightly packed the DNA must be inside a bacterium.

Q: Each nucleotide pair of a DNA double helix weighs about 1 × 10 −21 g. The human body contains…

A: DNA is a polynucleotide and each strand of DNA is made up of certain numbers of nucleotide, this is…

Q: 5' UGUCAUGCUCGUCUUGAAUCUUGU GAUCCUCGUUGGAUUAAUUGU— 3' Translate the sequence of bases in the…

A: The amino acid chains are produced from the mRNA by the process of translation. In this translation…

Q: 3. A molecule with the following composition is replicated in a solution of adenine nucleoside…

A: Replication is a process of DNA dependent DNA synthesis. The process of replication is catalyzed by…

Q: The Bacteria Escherichia coli DNA genome has a molecular mass of about 3.1 X 10 9 D. In your…

A: Hi! As you have posted multiple questions, I will be answering the first and third question for you.…

Q: Q.)The Bacteria Escherichia coli DNA genome has a molecular mass of about 3.1 X 109 In your answers,…

A: (A) No. Of base pairs in the bacterium continue Some important Data-- Molecular weight of one base…

Q: 1. If a DNA molecule contains 11% G, what % A does it contain? 2. The human genome contains 3…

A: 1. If a DNA molecule contains 11% G, what % A does it contain?  G = 1 1 % ( Given )A =?According to…

Q: DNA exists in cells as a double-stranded duplex molecule, whereas RNA, which is composed of very…

A: DNA and RNA are found in diverse forms and structures to facilitate particular functions. These…

Q: One gram of cultured human cells contains about 10^9 cells and occupies roughly 1 mL. if the average…

A: 1 gram cells = 109 cells 1 cell = 6.4×109 bp per cell 1 bp molecular weight = 660 daltons

Q: Supercoiled DNA is slightly unwound compared to relaxed DNA and this enables it to assume a more…

A: DNA is supercoiled structure which is present inside the nucleus The coiling of Dna is done by the…

Q: Human DNA contains 20% Con a molar basis. What are the molepercents of A, G, and T?

A: The genetic material in most living beings is Deoxyribonucleic acid (DNA). It is a complex molecule…

Q: As we have focused on DNA, the molecule that stores genetic information in all living things. In…

A: The structure of DNA as double helix was described first by Watson and Crick by using the data of…

Q: True or False.  In a comparison between the DNAs of related organisms such as humans and mice,…

A: Conserved sequences in related organisms are compared by comparing their proteins.

Q: the human immunodeficiency virus HIV uses RNA rather than DNA to encode genetic information. During…

A: Answer: Introduction: The human immunodeficiency viruses (HIV) are the type of a subgroup of…

Q: Z-DNA derives its name from the zig-zag conformation of phosphate groups. What features of the DNA…

A: There is various possible double helical structure of the DNA; Z-DNA is one of them. In Z-DNA, helix…

Q: 1. If a DNA molecule contains 11% G, what % A does it contain? 2. The human genome contains 3…

A: The hereditary substance in human and almost all other species is DNA, or deoxyribonucleic acid.…

Q: Although human DNA has a total length of 2 m, it is packaged into a nucleus that is 5 µm in…

A: Cells wrap their DNA strands around scaffolding proteins to form chromatin, a coiled compact…

Q: Draw the following strands of DNA 5’ C-A-T 3’ as well as the complementary base pairing strand…

A: Two strands of DNA twist around one another to form a double helix DNA and both are in anti-parallel…

Q: The human genome contains 3 billion nucleotides arranged in a vast array of sequences. What is the…

A: Genes are the hereditary unit of an organism. The DNA (deoxyribonucleic acid) forms the genes. DNA…

Q: If the DNA of one human cell is stretched out, it would be almost 6 feet long and contain over three…

A: DNA  DNA is the hereditary unit of an organism which transfer from parents to their offsprings. It…

Q: Okazaki fragments in bacterial cells are 1000–2000 nucleotides in length. Those in eukaryotic cells…

A: In the bacterial cell, the length of the Okazaki fragment is 1000-2000 nucleotides, while in…

Q: 1 bp of DNA is approximately 0.34 nm in length. Abacterial chromosome is about 4 million bp in…

A: Bacteria are microorganism that most commonly occur in the soil, air, water and in adverse…

Q: Z-DNA derives its name from the zig-zag conformation ofphosphate groups. What features of the DNA…

A: Z-DNA is one of the many possible double helical structures of DNA. It is a left handed double…

Q: DNA isolated from the bacterial virus M13 contains 25% A, 33% T, 22% C, and 20% G. Do these results…

A: DNA  is deoxyribose nucleic acid it contains the nitrogenous bases of adenine guanine thymine and…

Q: Why are consensus sequences found in cis-elements typically only 5-6 bases long? Question 19…

A: The consensus sequence is the calculated order of most frequent residues, either nucleotide or amino…

Q: 5.1) Do you expect DNA strands 1 and 2 below to have the same melting point? Justify your answer.…

A: As per bartleby guidelines we are only allowed to answer one question. Please post the other…

Q: Make your DNA extraction buffer. Add 2 teaspoons of detergent, 1 teaspoon of salt, and ½ cup of…

A: The plasma membrane or cell membrane is made up of lipid bilayer that is situated between the…

Q: otal nucleic acids are extracted from a growing culture of yeast cells. They are then mixed with…

A: Although ssDNA could be a critical intermediary in practically all biological activities involving…

Q: If you analyze a double-stranded DNA molecule and find that 15% of all the nucleotide bases are…

A: According to Chargaff's rule, [A]+[G]=[C]+[T] where A - adenine G - Guanine C- Cytosine T- Thymine

Q: Proliferating Cell Nuclear Antigen (PCNA) is a ring-shaped protein that forms a clamp around DNA.…

A: Spectrophotometric analysis is the most widely accepted technique to determine the concentration of…

Q: 3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5'    Q:  Based on written…

A: The DNA has two strands one is the Template strand and other is the coding strand. Based on the…

Q: hi i need help with science homework if you do i give 5/5  if this sample is good i might even sign…

A: We’ll answer the first question since the exact one wasn’t specified. Please submit a new question…

Q: The λ DNA used for digestion was provided at a concentration of 2μg/μl. How much DNA (in micrograms)…

A: DNA is an organic molecule that includes genetic information as well as instructions for protein…

Q: 5’-GATCAGCTGACTGGATCCGTCCTCAACGTCAGGATCCAGCTTCAAG-3’ 1. How many cuts do you expect this enzyme to…

A: Some enzymes are called endonucleases cleave the phosphodiester bonds that exist in the DNA. Some…

Q: Nucleosome structure: Identify the proteins indicated by the arrow. Hint: there are two of these…

A: option -a)histone H2A-H2B diner is correct.

Q: 1. The Bacteria Escherichia coli DNA genome has a molecular mass of about 3.1 X 109 D. In your…

A: DNA (deoxyribonucleic acid) is a double helix structure that is made up of two intertwined…

Q: The DNA from sea urchins contains about 32% A and about 18% G. What percentages of T and C would you…

A: DNA (Deoxyribonucleic Acid) It is defined as a genetic material that stores genetic information…

Q: Amino acids have an average molar mass of 100 g/mol.How many bases on a single strand of DNA are…

A: Given: molar mass = 5.0×105 g/mol = 500000 g/mol average molecular weight of an amino acid = 100…

Q: (You can answer part (a) and part (c) together if it is more convenient to do so). DRAW condensed…

A: Biochemistry is a branch of science that deals with the study of chemical processes related to the…

Q: Show the separation pattern of the following DNA molecules on 1 % agarose gel. Justify your results.…

A: Introduction:  Agarose gel electrophoresis is a molecular biology technique to analyze and separate…

Q: A strand of nucleic acid is defined by its sequence of nucleotides: A, C, T, and G. How many…

A: Nucleic acids are large biomolecules or biopolymers which is vital for each known form of life. The…

Q: The average human chromosome contains about 1 x 108 bp of DNA. (a) If each base pair has a mass of…

A: Compaction ratio is the ratio of extended length to actual length. Length of total DNA is the…

Q: Electric Forces in Biology• Describe how a water molecule is polar.• Explain electrostatic screening…

A: Since we only answer 1 question in case of multiple questions, we’ll answer the first question as…

Q: A single strand of DNA, 24 nucleotides long, with the sequence 5'-TTTCCCgggAAAgggTTTAAAggg-3' is…

A: The given ssDNA would serve as a template strand for the synthesis of a complementary strand to form…

Q: The average human chromosome contains about 1 x 108 bp of DNA.(a) If each base pair has a mass of…

A: A chromosome is a long DNA molecule with part or all of the genetic material of an organism.

Q: A B-DNA molecule has 1 million nucleotide pairs. How many complete turns of the helix are there in…

A: Majority of DNA present in the cytoplasm of living cells exist in double helical structure as…

Q: Human cells have approximatelly 6,000,000,000 base pairs. How many errors per replication occur?

A: Human cells have approximatelly 6,000,000,000 base pairs. How many errors per replication occur?…

Q: True or False 1.) The Watson and Crick double stranded DNA structure is always antiparallel.

A: “Since you have asked multiple questions, we will solve the first question for you. If youwant any…

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.