DNA is chemically stable than RNA due to the on
Q: Eukaryotic cells have ___________ origins of replication along their DNA.
A: An outcome of the huge size of eukaryotic genomes is that different ( multiple ) causes of…
Q: The fragment of DNA in replication are called______fragments.
A: During DNA replication ,double helix is unwound and the complementary strands are separated with the…
Q: This happens during DNA transcription:
A: Hi! Thank you for the questions. As you have posted multiple questions, I will be answering the…
Q: QHat is DNA
A: DNA stands for deoxyribonucleic acid. It is present in the nucleus, mitochondria and chloroplast in…
Q: A key difference between the nucleotides found in DNA andthose in RNA is thata. DNA has phosphate,…
A: Deoxy ribonucleic acid (DNA) is he genetioc material of most organisms, while ribonucleic acid (RNA)…
Q: RNA is pretty easy to make into DNA because it's single stranded , doesn't form as many structures,…
A: The first step a cell takes to read out a genetic instruction is to copy a particular nucleotide…
Q: DNA replication follows a dispersive model True or false
A: DNA replication is the process of copying already present DNA in the cell. It uses many enzymes such…
Q: A......of a DNA consists of a sugar, a phosphate, and a nitrogen containing base. A....... is a…
A: DNA stands for Deoxyribonucleic acid. It is the genetic material in humans.
Q: Chemical and Radiation Damage to DNA Can Lead to ____________.
A: Deoxyribonucleic acid (DNA) is a molecule made up of two polynucleotide chains that coil around each…
Q: Replication of DNA begins at and transcription of RNA begins at
A: In DNA replication the double-stranded molecule of DNA is copied for making two identical DNA…
Q: The _______ strand of DNA that has the same sequence (with T's instead of Us) as the corresponding…
A: The DNA is referred to as the genetic blueprint of a cell because it contains the instructions for…
Q: Whole DNA chromosomes are kept in the nucleus while small nucleotide monomers move into and out of…
A:
Q: DNA is a large molecule and is wrapped around proteins called: O a. Histones O b. Ligase O c.…
A: DNA (deoxyribonucleic acid) is the molecule that conveys genetic information for an organism's…
Q: differentiates the DNA from RNA.
A: DNA: It stand for deoxyribonucleic acid, which is a molecule that contains the instructions an…
Q: In the DNA sequence 5'-ACTG-3', the phosphodiester linkage between the cytosine and the thymine…
A: DNA Deoxy-Ribo-Nucleic is a molecule which stores the genetic information and instructions for…
Q: Which of the following involves remarkable capacity of short segment of DNA to move from one place…
A: in order to find out the correct answer, let's analyse each option 1. transposition: DNA transposons…
Q: The _____________ strand is made continously.
A: DNA replication in eukaryotes is semiconservative, semicontinuous, and bidirectional. It occurs in…
Q: Errors in DNA are called mutations. what are some good and bad consequences of mutations
A: A mutation is a change in a genetic sequence. While most mutations are neutral , some can either by…
Q: If a molecule of DNA is made up of 21% adenine, there is of thymine, of guanine, and of cytosine.
A: Answer: Introduction: Rendering to the Chargaff's rules explained that a DNA by any cell of all…
Q: Histones and DNA have a strong attraction for each other because...
A: Histones are proteins that play an important role in the packing of DNA into cells, chromatin, and…
Q: The sequence of a DNA molecule also influences its melting temperature. Guanine-cytosine base pairs…
A: A molecule of DNA is a polymer of nucleotide. Each nucleotide consists of Deoxyribose sugar which is…
Q: A mutation is any change in the DNA. O True False
A: A mutation is any change on the DNA sequence that is not properly repaired. A section of nucleotides…
Q: DNA replication results in the creation of _____________ identical strands of DNA.
A: The consequence of DNA replication is two DNA molecules comprising of one new and one old chain of…
Q: An enzyme called _____________________ catalyzes theformation of a covalent phosphodiester bond…
A: DNA replication is the process of formation of complementary strands of DNA molecules from the…
Q: Biological functions of DNA
A: INTRODUCTION DNA is required for heredity, protein-coding, and delivering instructions for life and…
Q: The DNA of identical twins is an exact match.
A: Yes DNA of identical twins is an exact match and is 100% match as they are formed from the same egg…
Q: During DNA Replication, _____________ is synthesized in a series of short pieces called…
A: DNA is made up of various nucleotides that store genetic information in it. DNA is packed into a…
Q: DNA molecules can perform their function in replication and transcription as long as the hydrogen…
A: DNA is a double stranded molecule. The two strands are paired to each other by complementary base…
Q: The enzymes responsible for forming the final phosphoiester bond between two DNA fragments during…
A: The phosphodiester bonds constitute the backbone of the strands of DNA.
Q: DNA replication is bidirectional and discontinuous
A: DNA replication is a DNA dependent DNA synthetic process. DNA acts as the genetic material in the…
Q: A type of protein that associate with DNA, in Eukaryotes cell to compact the protein is Histamine.…
A: Introduction:- Watson and Crick suggested the DNA structure. They claim that DNA is a double-helical…
Q: DNA differs in composition from RNA in having deoxyribose and uracil rather than ribose and thymine.…
A: FALSE. DNA differs in composition from RNA in having deoxyribose and thymine rather than ribose and…
Q: double-stranded DNA is dissociated into
A: All organisms must replicate their DNA when cells divide. During DNA replication, an enzyme called…
Q: Which of the following is found in BOTH DNA and RNA structur
A: Nucleotides are chemical building units that makeup DNA. A phosphate group, a sugar group, and one…
Q: y the meaning of this statement: Genetic information is encoded in the DNA molecule.
A: Yes, Genetic information is encoded in the DNA molecule .It is also present in RNA molecule in some…
Q: the genetic information is coded in DNA by the the sequence of
A: The sequence of DNA bases is arranged into genes, most of which contain the instructions to create a…
Q: An enzyme that makes covalent bonds between nucleotide sequences in DNA is: O A) RNA polymeraco
A: DNA ( Deoxyribonucleic acid ) is made up of two anti parallel polynuceotide chains which coil around…
Q: Types of DNA inhibitors medicines
A: DNA inhibitors drugs are those chemical formulation that inhibit the DNA and its function.
Q: The Central dogma for biology includes: DNA to RNA which is called
A: Central Dogma is one of the most important concepts in Biology which involves the processes in which…
Q: Instead of Thymine, RNA uses O Adenine O Uracil O Cytosine O Udenine
A: There are five main nitrogenous bases two purines and three pyrimidines. Purines are adenine and…
Q: The process of making RNA (i.e. MRNA) from DNA is called Your answer
A: Transcription is generally the process in which DNA is shift to make a complete strand of RNA and…
Q: Transcription is..... dependent..... synthesis.
A: DNA/RNA
Q: If DNA segments changes from GCATAG to GCATA, this is a:
A: Mutation is a sudden, stable, and variable change in the genome of an organism. It may be due to…
Q: In 2 paragraphs. Discuss the differences between RNA and DNA, in terms of structure and function.…
A: The two important nucleic acids, DNA and RNA have some major differences based on their structure…
Q: A step-by-step process in order to alter the DNA of an organism (The five processes)
A: There are five steps involved to alter the DNA through a process named Genetic engineering. They are…
Q: meaning of this statement: Genetic information is encoded in
A:
Q: The molecule is responsible for bringing the code from DNA to the ribosome during protein synthesis.
A: Ans. The messenger RNA (mRNA), in molecular biology, is a single-stranded RNA molecule that matches…
Q: The significant of DNA replication
A: Introduction The process of replicating a double-stranded DNA molecule into two identical DNA…
Step by step
Solved in 3 steps
- Question:- 1. ATT GAC CAA ATC CAT TGA GAC CAA What chains occur when modified DDTP thymine is added to the DNA sequence above.Question People who carry a theoretical genetic disorder (called B-disease) can be identified from a 2kb DNA sequence. People who carry this genetic disorder have a single nucleotide polymorphism that results in a change of GTATTC to GGATTC, a site that only occurs once at nucleotide number 750 in this DNA sequence. Answer the following questions based on the information provided. (a) How can you develop a simple molecular test to identify the genetic disorder? (b) If you have carried out the molecular test (based on the information above) on a 100 individual and found that 24 were healthy (BB) and 26 were carriers (bb); (1) What is the ratio of heterozygous? (2) Show how can you identify the three types from the agarose gel.Question- You have a new microorganism that you have just isolated. You suspect your bacterium is capable of degrading cellulose. You know that these bacteria will have exoglucanases, endoglucanase, and β-glucosidases if they are able to degrade cellulose. 1. What DNA sequencing method would you use? 2. How would you predict the ORFs of the sequence you obtained? 3. How could you predict the functions of those proteins and its metabolic pathways? 4. What enzymes would you look for in the predicted functions of the ORF of the DNA sequence?
- Question:- What is the best description of tRNA (transfer RNA)? Question 15 options: It temporarily stores genetic information. It is an adaptor molecule that translates nucleotide information to polypeptide information. It is the RNA machinery for peptide bond formations. It encodes protein information.Question: DNA molecules are compressed by integrating with non-nucleic acids. What property of these DNA binding molecules make them most attracted to DNA-A) High PolarityB) Nonpolar BackbonesC) Large SizesD) Positive Charge Answer?MCQ QUESTION: In Bacteria, the UV-induced DNA damage will be repaired by ------- where -------- nitrogenous base is targeted. A- Photoreactivation repair/ b- thymine SOS repair/ C-adenine Mismatch repair/ D- cytosine Proofreading/guanine The DNA sequence (5'-ATACAMA-3') was exposed to Ethyl Methanesulfonate (EMS) which is a(n) _______ . The resulting DNA sequence will become __________ after one round of cell division.
- Question-1 During DNA replication, a.No errors occur b.only one strand of the molecule acts as a template c.Both strands of a molecule act as templates. d.The reaction is catalyzed by RNA polymeraseQuestion. Rewrite the following sentences after correction. (Subject: Biotechnology) The variation in the length of tandem repeat of microsatellite DNA has serious translational affects as this is due to its coding region. Correct: If one parent has sickle cell anemia and other has carrier genotype than there is 25 % chance that any offspring is carrier. Correct: Sickled WBC block the flow of blood and Calcium as they stick together and caused by frame shift mutation. Correct: The N1303K mutation in the CFTR gene of CF patients is autosomal dominant disorder due to insertion of asparagine at 1303. Correct: If a person RBCs have B surface antigen and it will clump with antigen B such clumping indicates Blood type B. Correct: Indirect ELISA can detect polygenic gene expression. Correct:Question- If chemically competent E coli cells are disrupted by CaCL2 and a heat shock to take up DNA, how would electrocompetent E coli cells take up DNA?
- Question:- Can you please explain the general rule on how to manually align these sequence?? i am very confused when you have to use a dash '-'. I have never been taught how to sequence so this to me is new and confusing i dont know what i am doing. any advice/tips would be great. please explain step by step as to why you added the dash so i can understand and learn. thank you so much Align the following sequences Sequence A: CUCGAGUUAACCCGGCACCCG Sequence B: GCUCGGGUUAACACGGACCCG Sequence C: UCGAGCCAACUCGGACCCGQuestion:- 1. Transcribe and translate the given region of DNA, note that the promoter region is to the right of the sequence, and translation must start from the start codon. Include 3' and 5' for RNA transcript and N- and C- terminus in your final peptide sequence. Use the 1-letter form of amino acids when writing the sequence of polypeptide 5' CCCCAGCGTAAGTTTATGGTTACTCATGAA 3' 3' GGGGTCGCATTCAAATACCAATGAGTACTT 5'Question:- Viral vectors are not the only method being studied for gene therapy purposes. Which of the following is a nonviral delivery method for gene therapy? a.gene pills b.DNA bound to the surface of liposomes c.electrically stimulating cells to take up DNA d.DNA covered with protein