DNA Repication Explanation (no ESSAY) Must include STEP BY STEP Leading strand with 5' and 3' Lagging strand with 3' and 5' - Okazaki fragments Bases (following the base pairing rule) Primase -Primer helicase Polymerase Ligase Parent Strands Daughter Strands New DNAs - semiconservative

DNA Repication Explanation (no ESSAY) Must include STEP BY STEP Leading strand with 5' and 3' Lagging strand with 3' and 5' - Okazaki fragments Bases (following the base pairing rule) Primase -Primer helicase Polymerase Ligase Parent Strands Daughter Strands New DNAs - semiconservative

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter28: Dna Metabolism: Replication, Recombination, And Repair

Section: Chapter Questions

Problem 1P: Semiconservative or Conservative DNA Replication If 15N-Iabeled E. coli DNA has a density of 1.724...

See similar textbooks

Related questions

Q: polymerase with 5'-3' as well as 3'-5' exonuclease and proofreading activity is Select one: a.…

A: The error-correcting processes used in the genetics is known as the proof reading. During the…

Q: Which of the following is NOT true regarding E. coli replication on the lagging strand? initially…

A: In molecular biology, DNA replication is the process of making two identical DNA molecules from one…

Q: In a Sanger DNA sequencing reaction (dideoxy method) you use the primer 5′-GCATATA-3′ to sequence a…

A: Sequencing of DNA refers to the biochemical methods for determining the order of the nucleotide…

Q: Polymerase chain reaction is—   a reaction involving a chain of different types of polymerases…

A: PCR is a technique to make many copies of DNA in vitro. It relies on thermostable Taq polymerase and…

Q: Reset Double-helical DNA Sugar-phosphate backbone (RNA) Base uracil in Phosphate group…

A: S.No. DNA RNA 1 Deoxyribonucleic Acid. Ribonucleic Acid. 2 Generally double…

Q: Prior to the action of DNA ligase, how many hydrogen bonds are holding these two DNA fragments…

A: Introduction DNA strand is composed of three components: Deoxyribose Sugar Nitrogenous Bases…

Q: Draw roughly the comparative electrophoretic mobilities of close circular DNA, open circular DNA and…

A: Gel electrophoresis is the technique of separation of molecules on the basis of their size and…

Q: The proofreading function of DNA polymerase involves the recognitionof a ________ and the removal of…

A: DNA stands for deoxyribonucleic acid. It is the genetic material of the organisms that transfer from…

Q: How many copies of double-stranded DNA are produced after 10 cycles of polymerase chain reaction?…

A: Polymerase Chain Reaction (PCR) is a technique by which a small amount of DNA can be amplified. For…

Q: Given the following eukaryotic DNA strand, transcribe and translate the DNA into a polypeptide using…

A: DNA strand – DNA is a Deoxyribonucleic acid. It is made up of two polynucleotide chains which are…

Q: Sometimes DNA polymerase makes a mistake, and the wrong nucleotide is added to the growing DNA…

A: Point mutation : It occurs as result of replacement of one nucleotide by other. point mutation bring…

Q: Sequencing of the following fragment of single-stranded DNA needs to be undertaken using the Sanger…

A: Sanger sequencing, also referred to as the “chain termination method”, may be a method for…

Q: Which of the following has 5’ to 3’ exonuclease activity? DNA polymerase I DNA polymerase III DNA…

A: The 5'-3' exonuclease activity's primary objective is to eliminate the RNA primers from newly…

Q: Figure 9.10 You isolate a cell strain in which the joining together of Okazaki fragments is impaired…

A: DNA replication in eukaryotes is semiconservative, semicontinuous, and bidirectional. It occurs in…

Q: DNA ladder 1 DNA ladder 2 bp ng/Sul 10000 8000 40 40 6000 3000 40 4000 40 700 600 3000 40 500 -2000…

A: Agarose gel electrophoresis is used to separate DNA molecules.

Q: DNA reacts with Biuret through ______________, and shows an absorbance in the visual region at…

A: DNA is also known as deoxyribonucleotide. DNA has double-stranded having two antiparallel strands…

Q: Proofreads each nucleotide its template as soon as it is added to the growing strand. A) DNA Ligase…

A: DNA is a genetic material that uses transcription and translation to transfer genetic information to…

Q: oner micro mole of 48 nulceotide dna was synthesised via solid phase .this sample contains salts…

A: DNA (deoxyribonucleic acid) is the polymer of nucleotides joined by a phosphodiester linkage. Each…

Q: Phosphorus is required to synthesize the deoxyribonucleoside triphosphates used in DNA replication.…

A: DNA replication is a semi-conservative process in which newly synthesized double helix DNA consists…

Q: Select the incorrect statement w.r.t. double helical structure of DNA. 1. The two chains of DNA run…

A: DNA is the hereditary material and is present in all organisms. It is present in the nucleus and a…

Q: Why are Okazaki fragments formed? A. Okazaki fragments are the result of discontinuous replication…

A: Answer : Option "E" is correct - Okazaki fragments are formed when the 5'-3' complementary strand…

Q: Please draw the DNA denaturation (DNA melting) curves corresponding to the three molecules and…

A: DNA denaturation is the breaking down of DNA molecule, for comparison or sequencing. DNA can be…

Q: DNA Polymerase Holoenzyme Il is represented below. It consists of several domains with distinct…

A: At the replication fork, DNA polymerase III holoenzyme (Pol III HE) works with the helicase and…

Q: Whatis the purpose of the dideoxynucleotides in DNA sequencing? OCH2 base - OCH2 base H. H. H. H. H.…

A: ddNTP(dideoxynucleotide triphosphate) used in sanger dna sequencing .which terminate the…

Q: CHOICES: Isoniazid Rifampicin Ethambutol None of the Choices Binds to bacterial DNA gyrase &…

A: DNA gyrase is an important enzyme that allows the bacteria to supercoil its NDA. The DNA gyrase is…

Q: Original ONA Strand A-C-C-G T-A-C T-G-G-AA-T-G Complementary DNA Strand What is the most likely…

A: DNA Replication is the synthesis of new daughter DNA strands complementary to the template DNA…

Q: Denaturation of DNA The two strands of the double helix DNA are held together by relatively weak…

A: Answer) Melting temperature: The temperature at which half of the DNA double helix starts…

Q: Dideoxysequencing relies on which one of the following choices: A):Random stopping of one of many…

A: Introduction :- Dideoxysequencing is used in sanger sequencing. Sanger sequencing is a DNA…

Q: Direction of new synthesis Ticket-out: Newly synthesized strand Something is wrong with replisome…

A: Through the diagram, we can observe that DNA polymerase III is acting on the parental strand and it…

Q: The epsilon subunit of DNA polymerase III is responsible for its _______ activity. A-5'---->3'…

A: DNA Polymerase III is an enzyme that is involved in DNA replication and synthesis. It has 3'-5'…

Q: An investigator obtalns a bacterial temperature-sensitive mutation that affects a step in the…

A: DNA (deoxyribonucleic acid) was discovered by Friedrich Miescher. Nucleotides are the structural…

Q: What is a true statement about the leading and lagging strands during DNA synthesis? The leading…

A: Ans : Correct statement for the above question is - The lagging strand is created due to DNA…

Q: his is responsible for breaking hydrogen bonds between complementary nucleotides of a DNA duplex…

A: Helicase is the enzyme responsible for breaking hydrogen bonds between complimentary nucleotides of…

Q: The proofreading function of DNA polymerase involves therecognition of a ________ and the removal of…

A: The process proof reading involves the removal of a newly added incorrect nucleotide. DNA polymerase…

Q: An unusual type of DNA helix that is left handed and can form under special conditions in DNA with…

A: DNA molecule comprises of two polynucleotide chains which wounds around each other for the formation…

Q: Which of the following is NOT a function of DNA polymerase III? Group of answer choices Exonuclease…

A: The main activity of DNA polymerase 3 is to add nucleotides to the short RNA primers. This is the…

Q: Below is a nucleotide base pair from B-DNA with three different regions indicated by A, B, and C. B…

A: B- DNA is the most common form of DNA. It is the right-handed helix and is present in humans which…

Q: Aflatoxin B1 is a highly mutagenic and carcinogenic compound produced by certain fungi that infect…

A: Aspergillus flavus and Aspergillus parasiticus are commonly known molds in soil, hay, grains, and…

Q: DNA Replication Explanation Must Include (no essay) Leading strand with 5' and 3' Lagging strand…

A: DNA replications starts offevolved with the disaasembly of DNA strands by using the movement of the…

Q: Single-strand binding proteins keep the two parental strands of DNA separated from each other until…

A: Deoxyribonucleic acid or DNA is the genetic material that is passed on from the parents to the…

Q: Which of the following steps is NOT part of a typical polymerase chain reaction? Choose an answer…

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: Which is the odd one out ? explain how the rest are connected. primers dNTPs DNA polymerase…

A: The polymerase chain reaction (PCR) is a widely used method for rapidly making millions to billions…

Q: Why does DNA replication only occur in the 5’ to 3’ direction? (A) 5' 3' (B) 5' 3' Should be PPP…

A: The central dogma of the cell is the process of the transfer of genetic material from DNA to…

Q: ollowing base removal, DNA polymerase can add nucleotides in the 5'-to-3' direction. Is that true…

A: DNA polymerase is the enzyme used for the replication of DNA. The polymerase uses the template DNA…

Q: True or False 1.) The Watson and Crick double stranded DNA structure is always antiparallel.

A: “Since you have asked multiple questions, we will solve the first question for you. If youwant any…

Q: Much of the human genome consists of repetitious DNA. Describe the difference between microsatellite…

A: Some of the similarities between microsatellite and minisatellite are that both are type of tandem…

Q: Which of the following substances adds equivalent DNA nucleotides to the 3' end of Okazaki fragments…

A: DNA polymerase I

Q: You are working in a biotechnology lab arid are analysing DNA. You obtain a sample of a short…

A: In a double-stranded DNA (deoxyribonucleic acid) molecule, the nitrogenous base pyrimidine hydrogen…

Concept explainers

Viral Replication

The virus is acellular and considered non-living outside the host cell. The replication of the virus occurs only inside the living cells. Only a few genes are present in the smallest virus, whereas many genes are present in the largest virus. These genes encode specific viral proteins.

Question

DNA Repication Explanation (no ESSAY) Must include STEP BY STEP

Leading strand with 5' and 3'
Lagging strand with 3' and 5' - Okazaki fragments
Bases (following the base pairing rule)
Primase -Primer
helicase
Polymerase
Ligase
Parent Strands
Daughter Strands
New DNAs - semiconservative

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

Step 2

Step 3

Step 4

Trending now

This is a popular solution!

Step by step

Solved in 4 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Given the choices,a. 25b. 18c. 23d. 21how many hydrogen bonds are present in a DNA double helix fragment consisting of the following sequence in one strand: ATTGCGGTCA
Which of the following DNA double helices would be more difficultto separate into single-stranded molecules by treatment withheat, which breaks hydrogen bonds?A. GGCGTACCAGCGCATCCGCATGGTCGCGTAB. ATACGATTTACGAGATATGCTAAATGCTCTExplain your choice.
DNA polymerase requires both a template, to be copied, and a primer, which provides a 3′ hydroxyl from which polymerase can extend. Yet, this molecule supports DNA polymerase activity. Explain. pTGACACAGGTTTAGCCCATCGATGGG -OH
The technique of dideoxy sequencing of DNA is described inChapter 20. The technique relies on the use of dideoxyribonucleotides(shown in Figures 20.5 and 20.16). A dideoxyribonucleotidehas a hydrogen atom attached to the 3′-carbon atom insteadof an –OH group. When a dideoxyribonucleotide is incorporatedinto a newly made strand, the strand cannot grow any longer.Explain why.
DNA Replication Explanation Must Include (no essay) Leading strand with 5' and 3' Lagging strand with 3' and 5' - Okazaki fragments Bases (following the base pairing rule) Primase -Primer helicase Polymerase Ligase Parent Strands Daughter Strands New DNAs - semiconservative
Which conformation of DNA – (i) totally double helix, (ii) minimally unwound or (iii) largely unwound – would have the highest relative absorbance at 260 nm. Would a molecule of DNA having a higher content of guanine and cytosine than of adenine and thymine have a higher or lower melting temperature (Tm) than one with the reverse composition?
At 260 nm what component of DNA absorbs at this nm(hydrogen bond, phosphate backbone, nitrogenous base, deoxyribose).
The introduction to this chapter, which describes the sequencing of 4000-year-old DNA, emphasizes DNA’s extreme stability. What aspects of DNA’s structure contribute to the stability of the molecule? Why is RNA less stable than DNA?
For entertainment on a Friday night, a genetics professor proposed that his children diagram a polynucleotide strand of DNA. Having learned about DNA in preschool, his 5-year-old daughter was able to draw a polynucleotide strand, but she made a few mistakes. The daughter’sdiagram (represented here) contained at least 10 mistakes. Q. Make a list of all the mistakes in the structure of this DNA polynucleotide strand.
DNA reacts with Biuret through ______________, and shows an absorbance in the visual region at ____________. DNA does not react with Biuret reagent Backbone phosphate groups; 280 nm Backbone phosphate groups; 260 nm Backbone phosphate groups; 540 nm
DNA polymerase requires both a template, to be copied, and a primer, which provides a 3′ hydroxyl from which polymerase can extend. Yet this molecule supports DNA polymerase activity. Explain. pTGACACAGGTTTAGCCCATCGATGGG−OH Match the items in the left column to the appropriate blanks in the sentence on the right.
Below is the sequence of a single strand of a short DNAmolecule. On a piece of paper, rewrite this sequenceand then write the sequence of the complementarystrand below it.GTTCGCGGCCGCGAACComparing the top and bottom strands, what do younotice about the relationship between them?