Using the table of genetic code, choose the CORRECT protein sequence that will be produced from the followingsense strand of DNA: 5'-AUG UCU GAC UAG TTG GAT CCC - 3'Second positionFirst position(5' end)Third position(3' end)PheSerTyrCysUPheSerТутCysLeuSerStopStopA.LeuSerStopTrpLeuProHisArgLeuProHisArgLeuProGlnArgLeuProGlnArgIleThrAsnSerUIleThrAsnSerIleThrLysArgAMetThrLysArgValAlaAspGlyUValAlaAspGlyCValAlaGluGlyAValAlaGluGlyO a. Lys-His-Ala-Gly-Asn-Leu-ValO b. Val-Val-Ser-Pro-Leu-Asp-Thr IleThrAsnSerIleThrAsnSerIleThrLysArgAMetThrLysArgValAlaAspGlyUValAlaAspGlyValAlaGluGlyValAlaGluGlyO a. Lys-His-Ala-Gly-Asn-Leu-Valb. Val-Val-Ser-Pro-Leu-Asp-Thrc. Val-Ile-Gln-Arg-Pro-Tyr-Phed. Met-Ser-Asp-Pro-Leu-Asp-Proe. Met-Ser-Asp

Name: Using the table of genetic code, choose the CORRECT protein sequence
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Using the table of genetic code, choose the CORRECT protein sequence that will be produced from the followingsense strand of DNA: 5'-AUG UCU GAC UAG TTG GAT CCC - 3'Second positionFirst position(5' end)Third position(3' end)PheSerTyrCysUPheSerТутCys

Genetic code is a triplet code called a codon. There are 64 codon out of which three codon do not…

Science

Biochemistry

Using the table of genetic code, choose the CORRECT protein sequence that will be produced from the following sense strand of DNA: 5'-AUG UCU GAC UAG TTG GAT CCC - 3' Second position First position (S' end) Third position (3' end) G Phe Ser Тyr Cys Phe Ser Tyr Cys C. Leu Ser Stop Stop Leu Ser Stop Trp Leu Pro His Arg Leu Pro His Arg Leu Pro Gln Arg Leu Pro Gln Arg Ile Thr Asn Ser Ile Thr Asn Ser Ile Thr Lys Arg A Met Thr Lys Arg Val Ala Asp Gly U Val Ala Asp Gly Val Ala Glu Gly A Ala Glu Gly G Val O a. Lys-His-Ala-Gly-Asn-Leu-Val b. Val-Val-Ser-Pro-Leu-Asp-Thr

Using the table of genetic code, choose the CORRECT protein sequence that will be produced from the following sense strand of DNA: 5'-AUG UCU GAC UAG TTG GAT CCC - 3' Second position First position (S' end) Third position (3' end) G Phe Ser Тyr Cys Phe Ser Tyr Cys C. Leu Ser Stop Stop Leu Ser Stop Trp Leu Pro His Arg Leu Pro His Arg Leu Pro Gln Arg Leu Pro Gln Arg Ile Thr Asn Ser Ile Thr Asn Ser Ile Thr Lys Arg A Met Thr Lys Arg Val Ala Asp Gly U Val Ala Asp Gly Val Ala Glu Gly A Ala Glu Gly G Val O a. Lys-His-Ala-Gly-Asn-Leu-Val b. Val-Val-Ser-Pro-Leu-Asp-Thr

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 16QP: Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also,...

See similar textbooks

Similar questions

Figure 28.41 gives some examples of recombination in IgG codons 95 and 96, as specified by the Vkand Jkgenes. List the codon possibilities and the amino acids encoded if recombination occurred in codon 97. Which of these possibilities is less desirable?
If the genetic code used 4 bases at a time, how many amino acids could be encoded?
The genetic code consists of a series of three-base wordsthat each code for a given amino acid.(a) Using the selections from the genetic code shown below, de-termine the amino acid sequence coded by the following seg-ment of RNA: UCCACAGCCUAUAUGGCAAACUUGAAG AUG= methionine ;CCU= proline; CAU= histidine ;UGG= tryptophan AAG= lysine ; UAU= tyrosine ;GCC= alanine ;UUG= leucine ;CGG= arginine ;UGU= cysteine ;AAC =asparagine ;ACA=threonine ;UCC= serine ;GCA=alanine ;UCA=serine(b) What is the complementary DNA sequence from which this RNA sequence was made? (c) If you were sequencing the DNA fragment in part (b), how many complementary chain pieces would you obtain in the tube containing ddATP?
Given a sequence of a DNA coding strand: 5’-ATGATTATCCTATAG-3’ What is the sequence and direction of the mRNA strand synthesized from this DNA?
Using the codon table, identify a 5’-3’ sequence of nucleotides in the dna template strand for mRna coding for the polypeptide sequence NH2-PHe-Pro-lys-COOH.
A particular protein has the amino acid sequenceN . . . Ala-Pro-His-Trp-Arg-Lys-Gly-Val-Thr . . . Cwithin its primary structure. A geneticist studyingmutations affecting this protein discovered that several of the mutants produced shortened protein molecules that terminated within this region. In one ofthem, the His became the terminal amino acid.a. What DNA single-base change(s) would cause theprotein to terminate at the His residue?b. What other potential sites do you see in the DNAsequence encoding this protein where mutation ofa single base pair would cause premature termination of translation?
Suppose the codon sequence GCCAUUCAAGCGGAU has a single base pair mutation to GCCAUUCAAACgGAU. If the old protein sequence was Ala-Ile-Gln-Ala-Asp, what will be the new sequence encoded by the mutant gene? _________(Use the 3-letter amino acid abbreviations with hyphens and no spaces in between, i.e. Ser-Asn-Tyr-Le
The template strand of a double helical segment of DNA consists of the following sequence: 5’-GTAGCCTTAAGCGATCACCGTCCGTATTACTAGTGGCCAGACTCTTTTCACTCTCATGTATAGTTG-3’ What is the nucleotide order in the complementary mRNA that can be transcribed from the given DNA strand?
Given this DNA strand: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ Identify the following: mRNA: polypeptide chain:
The template strand of a double helical segment of DNA consists of the following sequence: 5’-GTAGCCTTAAGCGATCACCGTCCGTATTACTAGTGGCCAGACTCTTTTCACTCTCATGTATAGTTG-3’ What will be the overall anti-codon sequence in tRNA?
The template strand of a double helical segment of DNA consists of the following sequence: 5’-GTAGCCTTAAGCGATCACCGTCCGTATTACTAGTGGCCAGACTCTTTTCACTCTCATGTATAGTTG-3’ Following translation process, what is the amino acid sequence that will be coded for? (show your answer using THREE-letter amino acid code starting from N-terminus to C-terminus)
The template strand of a double helical segment of DNA consists of the following sequence: 5’-GTAGCCTTAAGCGATCACCGTCCGTATTACTAGTGGCCAGACTCTTTTCACTCTCATGTATAGTTG-3’ Following translation process, what is the amino acid sequence that will be coded for? (show your answer using ONE-letter amino acid code starting from N-terminus to C-terminus)